ZFIN ID: ZDB-ALT-090611-6
Genomic Feature: hu2898
Synonyms:
Affected Genomic Regions: fmr1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 14: 20167829 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TAAAAACACCTCACTAATTGTTTTCAGTGTAACATGGGTTACTCTCATAATTCATGCAAAGCATCATGGGTTGTTATAAAATTTTAAAAGCAACTTCAAAAGCAGTTAAAACAAAGTAAAACATTATGCTCATATTTATTATTTCAAATCAATGCAGGTACTCAAGATAAACAATTTGCACACAAGACATTCATTTTCTAGATTGTGTTCTATAAAAGCCTACTGCAGCTGTCTCTATTAGATTGTGTAAATCCTTTTGAAAGAAGACCATAAGCATTTACAGCTTAGCAGATATCATAAAAGCACAAAAGACACACTTTATACACTAAAGAAAAAGAAAACCGTTGCAAACCTATTGTATGTATGACCTTCTCAAGCACAACAAATGTATATTGAAAACCAAAGCATACTCTATATAGATCTAAACCTAGAGATTAACAAAAGTTGAATATCAGAATATTAAAAACAGGTAAGATTCAAAATCTTGTTATATCTTCATC
A/G
GAGTTCTCGGCAGCTGGCCTCAAGGTTTCATGAACAGTTTGTGGTGCGGGACGATCTCATGGGATTGGCCATTGGCACCCATGGAGCAAACATCCAGCAAGCCAGAAAGATTTCTGGAGTTACAACCATTGATCTCGATGAAGAGACATGCACGTTTCACATCTATGGAGAGGTAAGCACTTTATCTGTGACTTTCTGCTTTACATAAATAGGACTGCAATCAGAATATGTAAGCCTGATTACGCACATCTGAGATTTTTGCGATCCTGTTTGAACTCCAGGACCAGGAGGCTGTACGGAAGGCCCGAAGCTACCTGGAATTTTCAGAAGATGTTATCAAAGTTCCTAGGAATTTAGTCGGTGAGGACAGATAAAATGAACAGCCTTCTCCTTCACATACTAGACCTGATGGTTAATAGGATTCGTTAAATTACTTTCTACAGGAAAAGTCATTGGCAAGAGTGGGAAGCTGATTCAAGAGGTTGTGGATAAATCGGGTG
(1)
OTHER hu2898 PAGES
ZMP:hu2898 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fmr1hu2898/hu2898 fmr1 ♀+/- ♂+/-
Complex fmr1hu2787/+; fmr1hu2898/+ (TL) fmr1
Unknown fmr1hu2898 fmr1 Unknown

CITATIONS  (6)