Genomic Feature

b1086

ID
ZDB-ALT-071023-1
Name
b1086
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Kimmel Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 43597678 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T at position 172 in Exon 2 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Lys>Stop (1)
Sequences
Flanking Sequence
ACACGTTCCCTCAAAAACAAACAAACAATCCCTCAAAAACAAACACAATCCCTCAAAAACAACCACACGTTCCCTCAAAAACAACCACACGTTCCTTCAAAAACAACCACACGTTCCTTTAAAAACAAACACACGTTCCCTCAAAAACAAACACATGTTCTCTTAAAAGCAACTACATGTTCTTTAAAAAAAACACATAGTCTCTCAAAAACAACCACACGTTCCTTTAAAAACAAACACACGTTCTCTCAAAAACAACCACACGTTCTCTCAAAAACACGTTCTCTTAAAAACAAACACGTTCTCTCAAAAATAACCAAACATTCTCTCAAATACAACCACACGTTCTCACAAAAACAACCACACATTTTCTCAAAACTCTACTGAAACAAAATAGTTAGTCAAAAAAAGGCCAAACTCAACAGGAACTGAGCTGGAACTTACCTCCACGATGTCTGAATTAGTCCGACTCTCGTGCGGCTCGTTGTACTCGGTGTATT
T/A CAGCAGAACTTTGTCCATGTCCGTGCTGGCGTACTGGAAGAGTTTATTAGTGCTGTTGAAGATGATGAGGGCGATCTCACAGTCACACAATACGCTCAGCTCGTAGGCCTTCTTCATCAGTCCAAACTTCCTCTTTGTAAACGTAACCTGATGAACAAAAAAATAATAGAAACTTTACTCTTGGATCAATTAAACAGATTTAGTTCCATGACATGAAATTTTTTAGCTAAATTGACATGTTACACCTAAACGAATTTTTACAGAATTTCACTTACAGAGGGTGCCAAATGTATTATTTAGTATATAATGTAGTACCGTAGAGTTCGCTATATTGGTTTTTTGACATTAGAAATTGACAATGGAAGTTTGACATTTCTATTGTCTGTACTATTTGCAGTATGTTTCTCTATTTGCATGTGTTGTGAGAATTTGCATGCATGCGTGCTGTCCTATTAATGATGTTTTCTCAGTTTGCAAGTGTTTTTCTATTTGCCTGCTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
b1086.pdf
Citations