ZFIN ID: ZDB-ALT-070803-3
Genomic Feature: st72
Synonyms:
Affected Genomic Regions: bmp4 (1)
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Talbot Lab
Location: Chr 17: 50584131 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T in Exon 4 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Glu>Stop at position 209 (1)
FLANKING SEQUENCE (GENOMIC)
AAAATCTGCAGAACATCTGACCTCCAGGAACAGGTTTGGTGATCCCAATACCAGAAGCTTCTCGGCAGGTGTGTTGAAGCAAGTCGGAACTAAACTCTGCAGGACACCGGCCCTCCAGGACCAAGTCTGGGCACCCCTGCTCTCAACTATCAATGAGACAACAGGTTTCTAAGATGTAAAGAAGCAGTTTCTGATTTTGACTGGTGTGTTTTTGTCCTCCTCTAGAGCACCTGGAGGAGCTGCAGTCAGACAGCTCCCAGGAGACTCCTCTGCGATTCGTTTTTAATCTCAGCAGCATCCCAGAGGACGAACTCATATCCACCGCAGAGCTTCGCGTCTACAGGCAACAAATAGATGACGCCTTCTCAGACCCAGATCAAACAGGGGACCATGGTTTGCATCGGATAAACATATATGAGGTGTTGAAGGCGCCACGGGAAGGACAGCTCATCACGCAGCTCCTGGACACACGTTTGGTGAGGCACAACACCTCCAAATGG
G/T
AAAGTTTCGACGTTAGCCCTGCAGTGTTGCGCTGGACCCAAGAAAAACGCTCTAATCATGGCCTTGCTGTGGAGGTTGTACAAATGAAGCGAAACCCAGTTCAAAAGGGACGACATGTTCGTGTAAGTCGCTCCGTGCATCCTCTTCCGGATGAAGAGTGGGACCAGCTACGCCCCCTGCTGGTCACATTCGGACATGACGGCAAAAGTCACCCGCTGACTCGGCGAGCGAAACGCAGCCCTAAACAAAGAGGTCGAAAGCGTAATCGTAACTGCCGGAGACATGCGCTGTATGTGGATTTCAGCGACGTAGGCTGGAACGACTGGATTGTGGCACCGCCTGGATATCAGGCGTATTACTGTCATGGAGAGTGTCCCTTTCCATTAGCCGATCATCTCAACTCCACCAATCACGCTATCGTACAGACACTGGTGAACTCGGTGAACACCAATATCCCCAAAGCCTGCTGCGTGCCCACTGAGCTCAGCGCAATCTCCATG
(1)
OTHER st72 PAGES No links to external sites

CITATIONS  (11)