header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-070730-8
Genomic Feature: sa2
Synonyms: sa0002 (1), sst (1), stocksteif (1)
Affected Genomic Regions: cyp26b1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 25324630 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CCCAGCAGCTCTGGCAGCTGAGGTGGACCGCAACACGGGACAAGAGCTGC
A/T
AGCTGCCCATGCCCAAGGGCTCCATGGGGTTCCCCATCATCGGAGAAACA
(1)
OTHER sa2 PAGES
ZMP:sa2 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cyp26b1sa2/sa2 cyp26b1 ♀+/- ♂+/-
Heterozygous cyp26b1sa2/+ (AB) cyp26b1 Unknown
Complex cyp26b1sa2/+; cyp26b1sa3/+ cyp26b1
Unknown cyp26b1sa2 cyp26b1 Unknown

CITATIONS  (11)