header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SSLP-980528-1969

Mapping Details

SSLP: z22103
PHYSICAL MAP AND BROWSERNo data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 41.0cM z22103 Boston MGH Cross (MGH) Fishman, Mark C. Data
12 132.21cR Z22103 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
12 1396.0cR z22103 Goodfellow T51 (T51) Geisler, Robert Data
12 46.4cM z22103 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
w39 Feature 12 46.4KB Hailey et al., 2012 Hailey et al.(2012, PLoS Genet. 8(10):e1002971) mapped persw39 to  ...
z23536 SSLP 12 Hailey et al., 2012 Hailey et al.(2012, PLoS Genet. 8(10):e1002971) mapped persw39 to  ...
z10352 SSLP 12 Hailey et al., 2012 Hailey et al.(2012, PLoS Genet. 8(10):e1002971) mapped persw39 to  ...
slc16a6a GENE 12 Hugo et al., 2012
z24996 SSLP 12 Hugo et al., 2012
z26278 SSLP 12 Hugo et al., 2012
z8450 SSLP 12 Hugo et al., 2012
s951 Feature 12 Hugo et al., 2012
kc17 Feature 12 2.3cM Mohideen et al., 2003 Mohideen et al. (2003, Dev. Dyn. 228(3):414-423) report mapping hht  ...

OTHER MAPPING INFORMATION
Chr 12 Hugo et al., 2012
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 0,194 60.0
Forward Primer AGCTTTCAGAGGAGGATGCA
Reverse Primer TGTTGCCATGAGAGGAATCA
IND 0,176 60.0
Forward Primer AGCTTTCAGAGGAGGATGCA
Reverse Primer TGTTGCCATGAGAGGAATCA
EKW 0,194 60.0
Forward Primer AGCTTTCAGAGGAGGATGCA
Reverse Primer TGTTGCCATGAGAGGAATCA
TU 0,194 60.0
Forward Primer AGCTTTCAGAGGAGGATGCA
Reverse Primer TGTTGCCATGAGAGGAATCA