header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SSLP-980528-1390

Mapping Details

SSLP: z10432
PHYSICAL MAP AND BROWSERNo data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
21 39.4cM z10432 Boston MGH Cross (MGH) Fishman, Mark C. Data
21 203.27cR Z10432 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
21 4121.0cR z10432 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
w29 Feature 21 Kennedy et al., 2004 Kennedy et al. (2004, Dev. Biol. 270(2):336-349) mapped chk w29 to LG 21 corresponding to rx3 using SSLPs.
z7925 SSLP 21 Kennedy et al., 2004 Kennedy et al. (2004, Dev. Biol. 270(2):336-349) mapped chk w29 to LG 21 corresponding to rx3 using SSLPs.
sbu2 Feature 21 Kok et al., 2007 Kok et al. (2007) show that SBU2 maps to linkage group 21 between Z7809 and  ...
z7809 SSLP 21 Kok et al., 2007 Kok et al. (2007) show that SBU2 maps to linkage group 21 between Z7809 and  ...
s399 Feature 21 Loosli et al., 2003

OTHER MAPPING INFORMATION
Chr 21 Loosli et al., 2003
Chr 21 Kennedy et al., 2004 Kennedy et al. (2004, Dev. Biol. 270(2):336-349) mapped chk w29 to LG 21 corresponding to  ...
Chr 21 Kok et al., 2007 Kok et al. (2007) show that SBU2 maps to linkage group 21 between Z7809 and Z10432
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 260,242 60.0
Forward Primer CAAAATAAGGGGCCTTGACA
Reverse Primer GATGACTGCTCTCCCTCGAC
IND 226,0,248 60.0
Forward Primer CAAAATAAGGGGCCTTGACA
Reverse Primer GATGACTGCTCTCCCTCGAC
TU 210,0,222 60.0
Forward Primer CAAAATAAGGGGCCTTGACA
Reverse Primer GATGACTGCTCTCCCTCGAC
EKW 0,242 60.0
Forward Primer CAAAATAAGGGGCCTTGACA
Reverse Primer GATGACTGCTCTCCCTCGAC