Genomic Feature

s399

ID
ZDB-ALT-020514-4
Name
s399
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
This T->A mutation is expected to convert the highly conserved tyrosine codon at position 479 to a stop codon.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 21: 10757057 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
This T->A mutation is expected to convert the highly conserved tyrosine codon  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Tyr>Stop at position 130 (1)
Sequences
Flanking Sequence
CTTTTTTTATTTAGCTCTTACAATTTAAGTAATTAGTATAATAGGCTATATTTATATATCTACGTTTTATGCACGTGTGTTTAGTACATTTTAGATTTCAGTGTTTAAAAAGTAGGTTAAATTTTTTTTTTTTTCAAAATTAAACAATGAAAAATGAACAGAAAATCTTAAGTATGCTATTTTAATTGAAAAGGTAATAAGGCATATAAATATGTGAAATATGGTAATCAAAGTTGTCAAAAATATGTCAGAATTATAAATATGAACATGTTGCACTTTCTCACATATTTCTCACTGTTGGTTTTTTTTTTTTTTTTCTCTCTCTCTCTTTATGCAGGAGTTTGTAGGTCGACTGTAATGGTCAGCCCAGATCTGCCAGACGCGGATGGTGGTAAATTGTCGGATGATGAAAACCCGAAGAAAAAGCACCGGCGGAACCGAACCACGTTCACCACCTTCCAGCTCCACGAGCTCGAGCGCGCCTTCGAGAAGTCGCACTA
T/A CCGGATGTCTACAGCAGAGAGGAGCTCGCGCTGAAGGTCAACCTGCCCGAAGTCCGAGTACAGGTGAGAGACACTTTATTCTGTTCAAACTAATACAGCAATAATAAATATTGTATATATGTATTTATTTGTTTAAAGATGGAGAAGTATAGGCTACTAAAATACAAATTCCACTTCTAACTTTTATGTCACTGAAAAAAATGTTTCATTGGATTTGCTGAATTATTTTAAGGTAAATTGTTGCAAACAATTTATATGGGCTAAAATTAAACAAGTTAAGTTGAAAATTACTAAATTTTTAACTCGTTTGTTTAATTCAGCCCATATAAACTGTTTGCAACTTAAACAAATAAATCCAATTAATAATTTTATTTAGTGTTGGCTATATGAAGTTTACTTGCAAAAAAACGGTTACTCTGTACAGATTTTTATAAATCCTGTTTTATTGTAGTACATTGAAGATATCATTATGAAAAAGAATTGTAAAAAATGATTGATGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations