ZFIN ID: ZDB-GENE-980526-561

Mapping Details

Gene Name: myogenic differentiation 1
Symbol: myod1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 25 33,825,102 - 33,827,308 GRCz12tu
NCBI Map Viewer 25 33,825,102 - 33,827,308 GRCz12tu
Ensembl 25 31,421,253 - 31,423,493 GRCz11
NCBI Map Viewer 25 31,421,253 - 31,423,459 GRCz11
UCSC 25 - GRCz11
Vega 25 30,843,777 - 30,846,017 GRCv10
Mapped Clones containing myod1
CH211-201M7 Chr: 25 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
fh261 25 31,422,905 GRCz11 DIRECT ZFIN Curated Data
hu2023 25 33,825,980 GRCz12tu DIRECT Sealy et al., 2025
25 31,422,131 GRCz11 DIRECT Busch-Nentwich et al., 2013
25 30,844,655 GRCz10 DIRECT Busch-Nentwich et al., 2013
25 32,265,402 Zv9 DIRECT Busch-Nentwich et al., 2013
hu2024 25 33,825,844 GRCz12tu DIRECT Sealy et al., 2025
25 31,421,995 GRCz11 DIRECT Busch-Nentwich et al., 2013
25 30,844,519 GRCz10 DIRECT Busch-Nentwich et al., 2013
25 32,265,266 Zv9 DIRECT Busch-Nentwich et al., 2013
fh261 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
hu2023 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
hu2024 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
myod1_unrecovered 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
25 114.3 cM myod Mother of Pearl (MOP) Postlethwait, John H. Data
25 365.81 cR myod Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
25 3341.0 cR myod Goodfellow T51 (T51) Geisler, Robert Data
25 72.5 cM myod Heat Shock (HS) Woods, Ian G. Data
25 76.6 cM myod Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
lamb4 GENE 25 Parsons et al., 2002 Parsons, et al. (2002. Dev 129:3137-3146.) report mapping lamb1 to LG25 approximately 0.42 cM from myod on the MOP mapping panel. Using the LN54 mapping panel, Parsons, et al. localize lamb1 approximately 20 cR away from myod and also found an EST (fa05e06) that corresponds to lamb4 that maps between myod and lamb1.
lamb1a GENE 25 20.0 cR Parsons et al., 2002 Parsons, et al. (2002. Dev 129:3137-3146.) report mapping lamb1 to LG25 approximately 0.42 cM from myod on the MOP mapping panel. Using the LN54 mapping panel, Parsons, et al. localize lamb1 approximately 20 cR away from myod and also found an EST (fa05e06) that corresponds to lamb4 that maps between myod and lamb1.

OTHER MAPPING INFORMATION
Markers Encoded by myod1
fb57a01 Chr: 25 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 750 DdeI 36.0
Forward Primer ATGAGGGATCTGTCCTGAGTG
Reverse Primer TTGTTCGTTTTCGTCGCTTT