Genomic Feature

fh261

ID
ZDB-ALT-080325-6
Name
fh261
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Moens Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 25: 31422905 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Mutation A376T, R126stop.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T at position 376 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Arg>Stop at position 126 (1)
Sequences
Flanking Sequence
CATTTGGTGTGTCATTGAAGTAAGAGCTGTCATAGCTGTTCCGTCTTCTCGTCTGACACGTTGGGCCCATAAAATCCATCTGGGAAACGAAAAGACACTTTAATCTATATTTATATTGAAAAGAAAATTAAATCAGCAAACACAAGAGATAAAATATTTACAAGCGATCTTTAATTATTCCCATCTTTCTCTTAAATGTTGAAAAATAATGTTGCTGAATTATCCTAAATTACAAAATCAGTGCAAAAAAACAAGTCCAAGTTTATTTGTCCAAGTAAACACTAAACGACTTATGGCTTAGCGACATCACAATTATACTGTAGCTATAGTATGTAAAAGCCTCAGTATATAAAATAAGTTTCTCACCATGCCATCAGAGCAGTTGGATCTCGGACTGGAAGCATCAGAGTCTCCACTGTAATGTTCCAGAACGGGATAGTAGTTATCCTCTTGACTTCTGAGAAGAGCCTGCAGAGACTCGATATAACTAATGGCGTTTC
T/A CAGAATCTCCACTTTGGGCAGCCTCTGGTTCGGGTTGGTGGACGTGCATCTCTTGAGGGTCTCGAAAGCGTCGTTGACCTTGCTCAGTCGCCTCCTCTCCCTCATGGTGGCGGCTTTGCGACGGTCAGCATTGGTAGTTTTTCTCTTGCAAGCTTTGCATGCCCACAGTAGGCACCTGCCGGCCTGATGATGCCCACTGGGCGCCCTCACGTGCTCGTCCTCGATGTGGTGATGCTCGTCGGGTTTGAGCAGGCTCACGTGAACAAGCCTGGGGTCCAAGTCTTCAAAGAAGTGCATGTCGTTGGTGTTGAAGCAAGGGTCGTCGTAGAAGTCATCAGCTGATGGGATGGGGAAGGGGATATCCGACAACTCCATCTTTTTTGTGTTAAAGTTTAAAAAGCAAGAAATGTACTTGAATGTTTCCAAAGTAGTAAATTTGTAAAAAAAATAAAAACCAAAATTAGGAATAGTAAGACAAAGTCCTTCAGATCCCGAAATAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations