header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-406

Mapping Details

Gene Name: orthodenticle homeobox 2b
Symbol: otx2b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 17 44,244,659 - 44,249,720
Ensembl 17 44,244,659 - 44,249,720
Vega 17 44,130,894 - 44,135,955
NCBI Map Viewer 17 44,244,659 - 44,249,715
UCSC 17 -
Mapped Clones containing otx2b
DKEY-166F24 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
hu3237 17 44,246,355 GRCz11 Busch-Nentwich et al., 2013
17 44,132,590 GRCz10 Busch-Nentwich et al., 2013
17 44,292,912 Zv9 Busch-Nentwich et al., 2013
hu3625 17 44,246,366 GRCz11 Busch-Nentwich et al., 2013
17 44,132,601 GRCz10 Busch-Nentwich et al., 2013
17 44,292,923 Zv9 Busch-Nentwich et al., 2013
sa36505 17 44,246,316 GRCz11 Busch-Nentwich et al., 2013
17 44,132,551 GRCz10 Busch-Nentwich et al., 2013
17 44,292,873 Zv9 Busch-Nentwich et al., 2013
tud44a 17 44,247,947 - 44,247,948 GRCz11 Kesavan et al., 2018

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 168.3cM otx2 Mother of Pearl (MOP) Postlethwait, John H. Data
17 364.97cR otx2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 4419.0cR otx2 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1073 36.0
Forward Primer GCGTCCTCATGGAAACTGAA
Reverse Primer CACATTACCGCTCCAGACAA