Genomic Feature

hu3625

ID
ZDB-ALT-100412-1
Name
hu3625
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Hubrecht Institute
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
Homozygous mutants die between 11 and 12 dpf.
otx2b hu3625 fish carry an A to C point mutation in the essential splice acceptor site of intron 2 (c.250-2A>C) that is predicted to ablate splicing from exon 2 to exon 3. Failure to splice is predicted to produce mRNA that would encode a truncated version of the protein, p.W85ter22, which is normally 289 amino acids. This A > C change generates a novel Msp1 site that is useful for genotyping WT, heterozygous and homozygous mutant fish.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 17: 44246366 (GRCz11) (1) Details
Nucleotide change
T/G
Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>C (1)
Transcript Consequence
Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
AGCCGAGCCCCGAGGCACCGTAACCTTGTGTGGGGAGGGACGCGGGGGACTGATTTAGGTGACTGGTGACAGCGTTGCTGCTCATGGGGCTCAAAGTGGATCCCGGCCCGGTCAGCTGATGGTGCATGGGCGTCAAGTATGAGCCGCAGTCCATACCCCCAAAGTAGGAAGTGGAACCAGCATAGCCCTGGCTATATCCAGACGCTTGAGTGTAGGTCATGGGGTAGGATCTTTGCATGCAGGAGGAGGAGGTAGAAAGTGGGTCTGACAGCGGCGAGATAGAGGCTGGGCTCCAAATAGACACCGGAGCGGTTGTGGTAGAGATGGCCGGGACTGAAGTGCTGGAGGGCGGGGTGAACTGGCCACTCGCCCCGCTCTCAGAACTGGCCTCCCGCGCTGGAGAGCTCTTCTTTTTGGCAGGTCGCACCTTGTTCTGGCCTCCGTTTTGTTGTTGTTGCTGCTGTTGGCGACACTTTGCCCTTCGGTTTTTGAACCAAACC
T/G GATGTGTTGAAAAAAAGGGGTTTTTATTATTTACGACGTGAACTAACGGCAGCACTATGGTCTTTATATATGCTCTGTTTGGTCTTCGCTCAAAATAAAACAAATGTGATATTGATAATATTTTAGTGCATCGCTCAGTTCATATAGATACAATACTTTTATTATTATTATAATTATTTAACTTTCTCATGAGTTGAAAGATGCGTACCTGTACACGGGACTCCGGCAAGTTGATTTTCAAGGCCACCTCCTCGCGCATGAAAATATCCGGGTAGCGTGTTTTCGCGAATAAAGCCTCCAGCACATCTAGTTGCGCTCTAGTAAATGTTGTCCTTTCTCGTCTCTGCTTTCGAGGAGTCGCTGTTTTAAATAAACAAAAGCATCACAGGTTGTCATTTAATAAAAAACGTCCATGCTTAGATTTAATTATTAAATGTAAAAAATACTATAAATATTACACATTAACATATCTGAATCGGCACAGTACAACATGTTATACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations