ZFIN ID: ZDB-GENE-980526-306

Mapping Details

Gene Name: muscle segment homeobox 3
Symbol: msx3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 13 24,662,238 - 24,664,668 GRCz11
Ensembl 13 24,662,238 - 24,664,668 GRCz11
Vega 13 24,531,788 - 24,534,218 GRCv10
NCBI Map Viewer 13 24,662,238 - 24,664,669 GRCz11
UCSC 13 - GRCv10
Mapped Clones containing msx3
CH211-217G15 Chr: 13 Details
DKEYP-85D1 Chr: 13 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
ihb246 13 24,662,645 - 24,662,653 GRCz11 ZFIN Staff

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
13 90.0 cM msxc Mother of Pearl (MOP) Postlethwait, John H. Data
13 323.44 cR msxc Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
20 625.43 cR msxC Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
13 2021.0 cR msxc Goodfellow T51 (T51) Geisler, Robert Data
13 52.9 cM msxc Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by msx3
fc66g03 Chr: 13 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 462 36.0
Forward Primer GTGTGATGCGAAAATAAACTCCTG
Reverse Primer GCAAAATACTCTGTGTCCCAAAAG