ZFIN ID: ZDB-GENE-980526-284 |
Gene Name: | retinoic acid receptor, alpha a |
---|---|
Symbol: | raraa |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing raraa | |
---|---|
DKEY-56E5 | Chr: 12 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa31860 | 12 | 11,129,847 | GRCz11 | Busch-Nentwich et al., 2013 |
12 | 11,091,544 | GRCz10 | Busch-Nentwich et al., 2013 | |
12 | 12,235,891 | Zv9 | Busch-Nentwich et al., 2013 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
12 | 162.07 cR | rara2a | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
12 | 1550.0 cR | rara2a | Goodfellow T51 (T51) | Geisler, Robert | Data |
12 | 38.3 cM | rara2a | Heat Shock (HS) | Woods, Ian G. | Data |
12 | 36.17 cM | rara2a | Gates et al (GAT) | Talbot, William S. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
top2a | GENE | 12 | Hale et al., 2006 | ||
z23536 | SSLP | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
z4373 | SSLP | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
z9891 | SSLP | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
z10806 | SSLP | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
fc05c04 | EST | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
w24 | Feature | 12 | 1.6 cM | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. |
fb57a07 | EST | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
z15261 | SSLP | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. | |
fb04b08 | EST | 12 | Pietsch et al., 2006 | Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis. |
|
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 362 | 36.0 | |
Forward Primer | CAGTTGTAGCCCCTCCCTCT | ||
Reverse Primer | AGTCTCTGGTCATTGCAGGC |