ZFIN ID: ZDB-GENE-980526-437

ZFIN ID: ZDB-GENE-980526-437

Mapping Details

Gene Name:	T-box transcription factor Ta
Symbol:	tbxta

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	19	15,329,574 - 15,333,686	GRCz12tu
NCBI Map Viewer	19	15,329,574 - 15,333,686	GRCz12tu
Ensembl	19	14,187,540 - 14,191,592	GRCz11
NCBI Map Viewer	19	14,187,540 - 14,191,592	GRCz11
UCSC	19	-	GRCz11
Vega	19	14,325,345 - 14,329,397	GRCv10

Mapped Clones containing tbxta
CH73-285B23	Chr: 19 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
b160	19	14,190,079 - 14,190,080	GRCz11	DIRECT		Schulte-Merker et al., 1994
sa13983	19	15,332,911	GRCz12tu	DIRECT		Sealy et al., 2025
	19	14,190,817	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	19	14,328,622	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	19	30,637,134	Zv9	DIRECT		Busch-Nentwich et al., 2013
b160	19		GRCz11	GENERAL_LOAD	load data [singleton]
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
b195	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
b459	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
b487	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
kt338	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
kt501a	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
kt633	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
m147	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
m550	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa13983	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
tb244e	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
tbxta_unspecified	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
tc41	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
ts260	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
w181	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
zf3096Tg	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
19	69.4 cM	ntl	Mother of Pearl (MOP)	Postlethwait, John H.	Data
19	154.98 cR	ntl	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
19	66.6 cM	ntl	Heat Shock (HS)	Woods, Ian G.	Data
19	38.25 cM	ntl	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by tbxta
fc80a01 Chr: 19 Details

Genomic Feature b160 is an allele of tbxta

Chr 19

Postlethwait et al., 1994

Postlethwait, et al. (1994. Science 264:699-703.) mapped the no tail mutation (allele: b160) to ...

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	921	HinFI	36.0
Forward Primer	CCTCCTCAATGTACGATCCA
Reverse Primer	TCAAAGAGCCCAACAAATACA

Genomic Feature b195 is an allele of tbxta