Genomic Feature

b160

ID
ZDB-ALT-970730-11
Name
b160
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with g-rays
Lab of Origin
Kimmel Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 19: 14190079 - 14190080 (GRCz11) (1) Details
Nucleotide change
CG/ACAGCT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp inserted / 2 bp deleted (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TTATAAAAAAACATCCCACAATGTAAATAGGTTGTAATAAGAATATGAATAATAAGAATATGTGAATAACTCAATTTTGACAAAAATGTCAGATGGAACCTTATAATTCTAAGGTGACTATATATATATATATATATATGTATAAAAGTGTCCTTAAATGTCATTATGCATGATTACTTGCAATAACCCTAACGGTAAACCTTATTATACATAAAAATTAAAAATAAAGGTAAACACACAAATAATCATACTTTTTAAATCTTGAATAAAATTGGTAACACTATTTTTTTTTCCCCACATTTTGAGAAATTGAGTGAATTTGCTCTTACTGGTGGTAGTGCTGCGGTGGGAGTAATGGCTGGGATATGGAGCAGCTCTGTGGTTCCTCAAGCTGGAGTATCTCTCACAGTACGAACCCGAGGAGTGAACAGGGGCCCCATTGAACTGAGGAGGGCTGCTGCTGGGGCCCATGGGGCCGTTACTGGGCAGGAACCAGCCAC
CG/ACAGCT ACTGTTGGAGGAGGACACAAGTGTTAAATATGCTATAATACTGGGGGGAAGTTTGAGTTGTTTGCAGGATTAATGTTGCTTTACTTACGTTGTGAATATCCAGATTGCTGGTTGTCAGTGCTGTGGTCTGGGACTTCCTTGTGGTCACTTCTGTTGACAGAAACAAATCCTTTTTAGTTAACAATAAATTATTAATTATAAAATAAATTATCAAAACAGGATAAATGAATGGCTAATAATGTGTTTTTCTTTTACCTCTCTTTGGCATCGAGGAAAGCTTTGGCAAAAGGATTGTGTTTGATTTTCAGAGCGGTAATCTGAAAAAAAAGAAAAGAAAAAATCAATATGGAAAGTGCTCAATTTATGCAACATTTTGAGGAAAGAGGCAAAAGACACATCTCAAACACTCACCTCTTCATTCTGATATGCTGTGACTGCAATAAACTGTGTCTCAGGAAAAGACTGACTGCTGATCATTTTCTGAATCCCACCGACTTTCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations