ZFIN ID: ZDB-GENE-980526-176

Mapping Details

Gene Name: cyclin D1
Symbol: ccnd1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 7 69,627,591 - 69,634,959 GRCz12tu
NCBI Map Viewer 7 69,627,591 - 69,634,959 GRCz12tu
Ensembl 7 54,671,749 - 54,679,595 GRCz11
NCBI Map Viewer 7 54,670,054 - 54,677,422 GRCz11
UCSC 7 - GRCz11
Vega 7 54,402,097 - 54,409,943 GRCv10
Mapped Clones containing ccnd1
CH211-188I17 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
pfu6 7 54,677,108 - 54,677,109 GRCz11 DIRECT Engel-Pizcueta et al., 2024
sa14707 7 69,632,868 GRCz12tu DIRECT Sealy et al., 2025
7 54,675,331 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 54,405,679 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 54,579,403 Zv9 DIRECT Busch-Nentwich et al., 2013
sa21083 7 69,634,567 GRCz12tu DIRECT Sealy et al., 2025
7 54,677,030 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 54,407,378 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 54,577,704 Zv9 DIRECT Busch-Nentwich et al., 2013
sa34190 7 69,633,086 GRCz12tu DIRECT Sealy et al., 2025
7 54,675,549 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 54,405,897 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 54,579,185 Zv9 DIRECT Busch-Nentwich et al., 2013
la016165Tg 7 54,575,397 - 54,575,407 Zv9 ZFIN_Zv9 BurgessLin
la016166Tg 7 54,575,856 - 54,575,866 Zv9 ZFIN_Zv9 BurgessLin
la026147Tg 7 54,575,688 - 54,575,698 Zv9 ZFIN_Zv9 BurgessLin
la016165Tg 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
la016166Tg 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la026147Tg 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
pfu6 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa14707 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa21083 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa34190 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 147.6 cM cycd1 Mother of Pearl (MOP) Postlethwait, John H. Data
7 264.13 cR cycD1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 5890.0 cR cycd1 Goodfellow T51 (T51) Geisler, Robert Data
7 127.9 cM cnnd1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
fgf19 GENE unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ...
lto1 GENE unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ...
fgf4 GENE unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ...

OTHER MAPPING INFORMATION
Chr unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes  ...
Markers Encoded by ccnd1
fb52e01 Chr: 7 Details
fc45c08 Chr: 7 Details
fc83a12 Chr: 7 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 979 AciI 36.0
Forward Primer ACGTGGACCTCTCTTGCACT
Reverse Primer TCAGCCTTAAACGACGGACT
Genomic Feature pfu6 is an allele of ccnd1