ZFIN ID: ZDB-GENE-980526-406

Mapping Details

Gene Name: orthodenticle homeobox 2b
Symbol: otx2b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 17 49,231,423 - 49,236,484 GRCz12tu
NCBI Map Viewer 17 49,231,423 - 49,236,484 GRCz12tu
Ensembl 17 44,244,659 - 44,249,720 GRCz11
NCBI Map Viewer 17 44,244,659 - 44,249,720 GRCz11
UCSC 17 - GRCz11
Vega 17 44,130,894 - 44,135,955 GRCv10
Mapped Clones containing otx2b
DKEY-166F24 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
hu3237 17 49,233,119 GRCz12tu DIRECT Sealy et al., 2025
17 44,246,355 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 44,132,590 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 44,292,912 Zv9 DIRECT Busch-Nentwich et al., 2013
hu3625 17 49,233,130 GRCz12tu DIRECT Sealy et al., 2025
17 44,246,366 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 44,132,601 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 44,292,923 Zv9 DIRECT Busch-Nentwich et al., 2013
sa36505 17 49,233,080 GRCz12tu DIRECT Sealy et al., 2025
17 44,246,316 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 44,132,551 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 44,292,873 Zv9 DIRECT Busch-Nentwich et al., 2013
tud44a 17 44,247,947 - 44,247,948 GRCz11 DIRECT Kesavan et al., 2018
hu3237 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hu3625 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa36505 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tud40Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tud41Tg 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tud44a 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tud44Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
tud46Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
tud47Tg 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 168.3 cM otx2 Mother of Pearl (MOP) Postlethwait, John H. Data
17 364.97 cR otx2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 4419.0 cR otx2 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1073 36.0
Forward Primer GCGTCCTCATGGAAACTGAA
Reverse Primer CACATTACCGCTCCAGACAA
Genomic Feature tud47Tg is an allele of otx2b