ZFIN ID: ZDB-GENE-980526-406

Mapping Details

Gene Name:	orthodenticle homeobox 2b
Symbol:	otx2b

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	17	49,231,423 - 49,236,484	GRCz12tu
NCBI Map Viewer	17	49,231,423 - 49,236,484	GRCz12tu
Ensembl	17	44,244,659 - 44,249,720	GRCz11
NCBI Map Viewer	17	44,244,659 - 44,249,720	GRCz11
UCSC	17	-	GRCz11
Vega	17	44,130,894 - 44,135,955	GRCv10

Mapped Clones containing otx2b
DKEY-166F24	Chr: 17 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	Citations
hu3237	17	49,233,119	GRCz12tu	DIRECT	Sealy et al., 2025
	17	44,246,355	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	17	44,132,590	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	17	44,292,912	Zv9	DIRECT	Busch-Nentwich et al., 2013
hu3625	17	49,233,130	GRCz12tu	DIRECT	Sealy et al., 2025
	17	44,246,366	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	17	44,132,601	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	17	44,292,923	Zv9	DIRECT	Busch-Nentwich et al., 2013
sa36505	17	49,233,080	GRCz12tu	DIRECT	Sealy et al., 2025
	17	44,246,316	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	17	44,132,551	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	17	44,292,873	Zv9	DIRECT	Busch-Nentwich et al., 2013
tud44a	17	44,247,947 - 44,247,948	GRCz11	DIRECT	Kesavan et al., 2018
tud40Tg	17		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tud41Tg	17		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tud44a	17		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tud44Tg	17		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tud46Tg	17		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tud47Tg	17		GRCz11	OTHER_MAPPING	ZFIN Curated Data

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
17	168.3 cM	otx2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
17	364.97 cR	otx2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
17	4419.0 cR	otx2	Goodfellow T51 (T51)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	1073		36.0
Forward Primer	GCGTCCTCATGGAAACTGAA
Reverse Primer	CACATTACCGCTCCAGACAA

Genomic Feature tud44Tg is an allele of otx2b