Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 7 54,671,749 - 54,679,595 GRCz11 Ensembl 7 54,671,749 - 54,679,595 GRCz11 Vega 7 54,402,097 - 54,409,943 GRCv10 NCBI Map Viewer 7 54,670,054 - 54,677,422 GRCz11 UCSC 7 - GRCz11

Mapped Clones containing ccnd1
CH211-188I17	Chr: 7 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	147.6 cM	cycd1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
7	264.13 cR	cycD1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	5890.0 cR	cycd1	Goodfellow T51 (T51)	Geisler, Robert	Data
7	127.9 cM	cnnd1	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
fgf19	GENE	unknown		Katoh et al., 2003	Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ... Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes are clustered in the draft genome sequence AL929586. The order and orientation of these genes were : 5'-ccnd1-3' - 3'-oraov1-5' - 3'-fgf19-5' - 3'-fgf4-5'.
lto1	GENE	unknown		Katoh et al., 2003	Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ... Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes are clustered in the draft genome sequence AL929586. The order and orientation of these genes were : 5'-ccnd1-3' - 3'-oraov1-5' - 3'-fgf19-5' - 3'-fgf4-5'.
fgf4	GENE	unknown		Katoh et al., 2003	Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ... Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes are clustered in the draft genome sequence AL929586. The order and orientation of these genes were : 5'-ccnd1-3' - 3'-oraov1-5' - 3'-fgf19-5' - 3'-fgf4-5'.

OTHER MAPPING INFORMATION

Chr unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes  ... Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes are clustered in the draft genome sequence AL929586. The order and orientation of these genes were : 5'-ccnd1-3' - 3'-oraov1-5' - 3'-fgf19-5' - 3'-fgf4-5'.

Markers Encoded by ccnd1
fb52e01 Chr: 7 Details
fc45c08 Chr: 7 Details
fc83a12 Chr: 7 Details

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	979	AciI	36.0
Forward Primer	ACGTGGACCTCTCTTGCACT
Reverse Primer	TCAGCCTTAAACGACGGACT