| ZFIN ID: ZDB-GENE-980526-437 |
| Gene Name: | T-box transcription factor Ta |
|---|---|
| Symbol: | tbxta |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing tbxta | |
|---|---|
| CH73-285B23 | Chr: 19 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| b160 | 19 | 14,190,079 - 14,190,080 | GRCz11 | DIRECT | Schulte-Merker et al., 1994 |
| sa13983 | 19 | 15,332,911 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 19 | 14,190,817 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 14,328,622 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 30,637,134 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| b160 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| b195 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| b459 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| b487 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| kt338 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| kt501a | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| kt633 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| m147 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| m550 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| tb244e | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| tbxta_unspecified | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| tc41 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ts260 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| w181 | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| zf3096Tg | 19 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 19 | 69.4 cM | ntl | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 19 | 154.98 cR | ntl | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 19 | 66.6 cM | ntl | Heat Shock (HS) | Woods, Ian G. | Data |
| 19 | 38.25 cM | ntl | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by tbxta | |||
|---|---|---|---|
| fc80a01 Chr: 19 Details | |||
| Genomic Feature b160 is an allele of tbxta | |||
|---|---|---|---|
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 921 | HinFI | 36.0 |
| Forward Primer | CCTCCTCAATGTACGATCCA | ||
| Reverse Primer | TCAAAGAGCCCAACAAATACA |
| Genomic Feature w181 is an allele of tbxta |