ZFIN ID: ZDB-GENE-980526-16

Mapping Details

Gene Name: endothelin receptor Ba
Symbol: ednrba
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 1 32,142,682 - 32,172,619 GRCz12tu
NCBI Map Viewer 1 32,142,682 - 32,172,619 GRCz12tu
NCBI Map Viewer 1 28,603,768 - 28,629,624 GRCz11
Mapped Clones containing ednrba
BUSM1-27N24 Chr: 1 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
j3e1 1 28,627,337 GRCz11 DIRECT Parichy et al., 2000
j3e2 1 28,628,257 GRCz11 DIRECT Parichy et al., 2000
j3e3 1 28,628,088 GRCz11 DIRECT Parichy et al., 2000
b140 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
ihb437 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ihb441 1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
j3e1 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
j3e2 1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
j3e3 1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
j3e988 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
j3e1527 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
tan17X 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
tlf802 1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
1 82.1 cM ednrb1 Mother of Pearl (MOP) Postlethwait, John H. Data
1 266.9 cR ednrb1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
1 3231.0 cR ednrb1 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
bmp1l GENE 1 Reifers et al., 2000 fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM.
The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information.
pou4f1 GENE 1 Reifers et al., 2000 fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM.
The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information.
fgf8b GENE 1 17.5 cM Reifers et al., 2000 fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM.
The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 340 AluI 36.0
Forward Primer CACTGTGCTGGCTTCCACTG
Reverse Primer ATTCTTAAAGCGCTTGCTAACCAT
Genomic Feature tan17X is an allele of ednrba