| ZFIN ID: ZDB-GENE-980526-306 |
| Gene Name: | muscle segment homeobox 3 |
|---|---|
| Symbol: | msx3 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing msx3 | |
|---|---|
| CH211-217G15 | Chr: 13 Details |
| DKEYP-85D1 | Chr: 13 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| ihb246 | 13 | 24,662,645 - 24,662,653 | GRCz11 | DIRECT | ZFIN Staff | |
| 20 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 13 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 13 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 13 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 20 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| mn0245Gt | 20 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 13 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 13 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 13 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 20 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| tud18Gt | 13 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 20 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 20 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 13 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 13 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 13 | 90.0 cM | msxc | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 13 | 323.44 cR | msxc | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 20 | 625.43 cR | msxC | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 13 | 2021.0 cR | msxc | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 13 | 52.9 cM | msxc | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by msx3 | |||
|---|---|---|---|
| fc66g03 Chr: 13 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 462 | 36.0 | |
| Forward Primer | GTGTGATGCGAAAATAAACTCCTG | ||
| Reverse Primer | GCAAAATACTCTGTGTCCCAAAAG |
| Genomic Feature tud18Gt is an allele of msx3 |