| ZFIN ID: ZDB-GENE-980526-176 |
| Gene Name: | cyclin D1 |
|---|---|
| Symbol: | ccnd1 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ccnd1 | |
|---|---|
| CH211-188I17 | Chr: 7 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| pfu6 | 7 | 69,634,645 - 69,634,646 | GRCz12tu | DIRECT | Engel-Pizcueta et al., 2024 |
| 7 | 54,677,108 - 54,677,109 | GRCz11 | DIRECT | Engel-Pizcueta et al., 2024 | |
| sa14707 | 7 | 69,632,868 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 7 | 54,675,331 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 7 | 54,405,679 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 7 | 54,579,403 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa21083 | 7 | 69,634,567 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 7 | 54,677,030 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 7 | 54,407,378 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 7 | 54,577,704 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa34190 | 7 | 69,633,086 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 7 | 54,675,549 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 7 | 54,405,897 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 7 | 54,579,185 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| la016165Tg | 7 | 54,575,397 - 54,575,407 | Zv9 | ZFIN_Zv9 | |
| la016166Tg | 7 | 54,575,856 - 54,575,866 | Zv9 | ZFIN_Zv9 | |
| la026147Tg | 7 | 54,575,688 - 54,575,698 | Zv9 | ZFIN_Zv9 | |
| la016165Tg | 7 | GRCz11 | OTHER_MAPPING | ||
| 7 | GRCz11 | OTHER_MAPPING | |||
| 7 | GRCz11 | OTHER_MAPPING | |||
| la016166Tg | 7 | GRCz11 | OTHER_MAPPING | ||
| 7 | GRCz11 | OTHER_MAPPING | |||
| 7 | GRCz11 | OTHER_MAPPING | |||
| la026147Tg | 7 | GRCz11 | OTHER_MAPPING | ||
| 7 | GRCz11 | OTHER_MAPPING | |||
| 7 | GRCz11 | OTHER_MAPPING | |||
| zko2836A | 7 | GRCz11 | OTHER_MAPPING | ||
| 7 | GRCz11 | OTHER_MAPPING | |||
| 7 | GRCz11 | OTHER_MAPPING | |||
| zko2836B | 7 | GRCz11 | OTHER_MAPPING | ||
| 7 | GRCz11 | OTHER_MAPPING | |||
| 7 | GRCz11 | OTHER_MAPPING |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 7 | 147.6 cM | cycd1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 7 | 264.13 cR | cycD1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 7 | 5890.0 cR | cycd1 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 7 | 127.9 cM | cnnd1 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| fgf19 | GENE | unknown | Katoh et al., 2003 | Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, ... | |
| lto1 | GENE | unknown | Katoh et al., 2003 | Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, ... | |
| fgf4 | GENE | unknown | Katoh et al., 2003 | Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, ... |
|
| Markers Encoded by ccnd1 | |||
|---|---|---|---|
| fb52e01 Chr: 7 Details | |||
| fc45c08 Chr: 7 Details | |||
| fc83a12 Chr: 7 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 979 | AciI | 36.0 |
| Forward Primer | ACGTGGACCTCTCTTGCACT | ||
| Reverse Primer | TCAGCCTTAAACGACGGACT |
| Genomic Feature sa14707 is an allele of ccnd1 |