ZFIN ID: ZDB-GENE-980526-115

Mapping Details

Gene Name: nuclear receptor subfamily 2, group F, member 1a
Symbol: nr2f1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 5 53,815,949 - 53,822,862 GRCz12tu
NCBI Map Viewer 5 53,815,949 - 53,822,862 GRCz12tu
Ensembl 5 49,744,713 - 49,751,549 GRCz11
NCBI Map Viewer 5 49,744,782 - 49,751,528 GRCz11
UCSC 5 - GRCz11
Vega 5 49,093,202 - 49,100,038 GRCv10
Mapped Clones containing nr2f1a
DKEYP-10A3 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
ci1009 5 49,747,221 - 49,747,269 GRCz11 DIRECT Duong et al., 2017
ci1017 5 49,745,315 - 49,745,372 GRCz11 DIRECT Gafranek et al., 2023
el512 5 49,745,891 - 49,745,898 GRCz11 DIRECT Barske et al., 2018
sa11358 5 53,817,041 GRCz12tu DIRECT Sealy et al., 2025
5 49,745,762 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 49,094,251 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 51,528,553 Zv9 DIRECT Busch-Nentwich et al., 2013
sa14691 5 53,821,737 GRCz12tu DIRECT Sealy et al., 2025
5 49,750,408 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 49,098,897 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 51,533,199 Zv9 DIRECT Busch-Nentwich et al., 2013
sa20527 5 53,816,976 GRCz12tu DIRECT Sealy et al., 2025
5 49,745,697 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 49,094,186 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 51,528,488 Zv9 DIRECT Busch-Nentwich et al., 2013
sa40551 5 53,821,649 GRCz12tu DIRECT Sealy et al., 2025
5 49,750,320 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 49,098,809 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 51,533,111 Zv9 DIRECT Busch-Nentwich et al., 2013
sa45227 5 53,821,675 GRCz12tu DIRECT Sealy et al., 2025
5 49,750,346 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 49,098,835 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 51,533,137 Zv9 DIRECT Busch-Nentwich et al., 2013
sud21 5 49,745,798 - 49,745,801 GRCz11 DIRECT Chowdhury et al., 2024
ci1009 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ci1017 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
el512 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa11358 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa14691 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa20527 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa40551 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa45227 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sud21 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 145.3 cM svp44 Mother of Pearl (MOP) Postlethwait, John H. Data
5 3541.0 cR nr2f1 Goodfellow T51 (T51) Geisler, Robert Data
5 96.6 cM nr2f1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 963 HinFI 36.0
Forward Primer TGTTATTATCCGGGAGCAGC
Reverse Primer TGCACAGGCATATCATGGAT
Genomic Feature sa11358 is an allele of nr2f1a