ZFIN ID: ZDB-GENE-980526-306

Mapping Details

Gene Name:	muscle segment homeobox 3
Symbol:	msx3

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	13	27,878,316 - 27,880,747	GRCz12tu
NCBI Map Viewer	13	27,878,316 - 27,880,747	GRCz12tu
Ensembl	13	24,662,238 - 24,664,668	GRCz11
NCBI Map Viewer	13	24,662,238 - 24,664,669	GRCz11
UCSC	13	-	GRCz11
Vega	13	24,531,788 - 24,534,218	GRCv10

Mapped Clones containing msx3
CH211-217G15	Chr: 13 Details
DKEYP-85D1	Chr: 13 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
ihb246	13	24,662,645 - 24,662,653	GRCz11	DIRECT		ZFIN Staff
	20		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	13		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	13		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	13		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	20		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
mn0245Gt	20		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	13		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	13		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	13		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	20		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
tud18Gt	13		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	20		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	20		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	13		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	13		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
13	90.0 cM	msxc	Mother of Pearl (MOP)	Postlethwait, John H.	Data
13	323.44 cR	msxc	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
20	625.43 cR	msxC	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
13	2021.0 cR	msxc	Goodfellow T51 (T51)	Geisler, Robert	Data
13	52.9 cM	msxc	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by msx3
fc66g03 Chr: 13 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	462		36.0
Forward Primer	GTGTGATGCGAAAATAAACTCCTG
Reverse Primer	GCAAAATACTCTGTGTCCCAAAAG

Genomic Feature mn0245Gt is an allele of msx3