| ZFIN ID: ZDB-GENE-980526-29 |
| Gene Name: | deltaA |
|---|---|
| Symbol: | dla |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing dla | |
|---|---|
| CH211-133L11 | Chr: 1 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| dx2 | 1 | 54,018,777 | GRCz11 | DIRECT | Appel et al., 1999 |
| hi781Tg | 1 | 54,014,034 - 54,014,035 | GRCz11 | DIRECT | ZFIN Curated Data |
| hi840Tg | 1 | 54,014,153 - 54,014,154 | GRCz11 | DIRECT | ZFIN Curated Data |
| hi3499Tg | 1 | 54,013,553 - 54,013,554 | GRCz11 | DIRECT | ZFIN Curated Data |
| ion29h | 1 | 54,014,249 - 54,014,252 | GRCz11 | DIRECT | Jin et al., 2022 |
| sa19611 | 1 | 57,495,000 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 1 | 54,014,790 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 1 | 53,355,047 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 1 | 54,581,544 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| dx2 | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hi781Tg | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hi840Tg | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hi3499Tg | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ion29h | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| nkhspGFFDMC72AEt | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| zko1078a | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| zko1078b | 1 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 1 | 167.3 cM | deltaa | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 1 | 6594.0 cR | dla | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 1 | 92.9 cM | dla | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by dla | |||
|---|---|---|---|
| fa04c10 Chr: 1 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 452 | 36.0 | |
| Forward Primer | GAGCGGCGGGAGAAGGAC | ||
| Reverse Primer | TGGCAGAGCAGCATGTAGAGGA |
| Genomic Feature nkhspGFFDMC72AEt is an allele of dla |