ZFIN ID: ZDB-GENE-980526-406

Mapping Details

Gene Name: orthodenticle homeobox 2b
Symbol: otx2b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 17 49,231,423 - 49,236,484 GRCz12tu
NCBI Map Viewer 17 49,231,423 - 49,236,484 GRCz12tu
Ensembl 17 44,244,659 - 44,249,720 GRCz11
NCBI Map Viewer 17 44,244,659 - 44,249,720 GRCz11
UCSC 17 - GRCz11
Vega 17 44,130,894 - 44,135,955 GRCv10
Mapped Clones containing otx2b
DKEY-166F24 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
hu3237 17 49,233,119 GRCz12tu DIRECT Sealy et al., 2025
17 44,246,355 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 44,132,590 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 44,292,912 Zv9 DIRECT Busch-Nentwich et al., 2013
hu3625 17 49,233,130 GRCz12tu DIRECT Sealy et al., 2025
17 44,246,366 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 44,132,601 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 44,292,923 Zv9 DIRECT Busch-Nentwich et al., 2013
sa36505 17 49,233,080 GRCz12tu DIRECT Sealy et al., 2025
17 44,246,316 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 44,132,551 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 44,292,873 Zv9 DIRECT Busch-Nentwich et al., 2013
tud44a 17 44,247,947 - 44,247,948 GRCz11 DIRECT Kesavan et al., 2018
hu3237 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hu3625 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa36505 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tud40Tg 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tud41Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tud44a 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tud44Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tud46Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tud47Tg 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 168.3 cM otx2 Mother of Pearl (MOP) Postlethwait, John H. Data
17 364.97 cR otx2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 4419.0 cR otx2 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1073 36.0
Forward Primer GCGTCCTCATGGAAACTGAA
Reverse Primer CACATTACCGCTCCAGACAA
Genomic Feature hu3237 is an allele of otx2b
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.