ZFIN ID: ZDB-GENE-980526-474

Mapping Details

Gene Name: bone morphogenetic protein 2b
Symbol: bmp2b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 20 49,238,332 - 49,244,387 GRCz12tu
NCBI Map Viewer 20 49,238,332 - 49,244,387 GRCz12tu
Ensembl 20 45,893,173 - 45,899,149 GRCz11
NCBI Map Viewer 20 45,893,152 - 45,899,149 GRCz11
UCSC 20 - GRCz11
Vega 20 45,989,453 - 45,995,429 GRCv10
Mapped Clones containing bmp2b
CH211-213I16 Chr: 20 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source Citations
ihb986 20 45,898,452 - 45,898,456 GRCz11 DIRECT Zebrafish Nomenclature Committee
sa18243 20 49,241,277 GRCz12tu DIRECT Sealy et al., 2025
20 45,896,039 GRCz11 DIRECT Busch-Nentwich et al., 2013
20 45,992,319 GRCz10 DIRECT Busch-Nentwich et al., 2013
20 46,429,654 Zv9 DIRECT Busch-Nentwich et al., 2013
ta72a 20 45,898,787 GRCz11 DIRECT ZFIN Curated Data
tc300a 20 45,898,583 GRCz11 DIRECT ZFIN Curated Data
tdc24 20 45,895,886 GRCz11 DIRECT ZFIN Curated Data
zf3958 20 45,898,287 - 45,898,297 GRCz11 DIRECT Wu et al., 2022
bmp2b_unspecified 20 GRCz11 OTHER_MAPPING ZFIN Curated Data
ta72a 20 GRCz11 OTHER_MAPPING ZFIN Curated Data
tc300a 20 GRCz11 OTHER_MAPPING ZFIN Curated Data
tdc24 20 GRCz11 OTHER_MAPPING ZFIN Curated Data
umo34 20 GRCz11 OTHER_MAPPING ZFIN Curated Data
zf3705Tg 20 GRCz11 OTHER_MAPPING ZFIN Curated Data
zf3958 20 GRCz11 OTHER_MAPPING ZFIN Curated Data

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
20 176.7 cM bmp2 Mother of Pearl (MOP) Postlethwait, John H. Data
20 720.06 cR bmp2b Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
20 3812.0 cR bmp2b Goodfellow T51 (T51) Geisler, Robert Data
20 116.8 cM bmp2b Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z13626 SSLP 20 Kikuchi et al., 2000 Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20,  ...
z20046 SSLP 20 Kikuchi et al., 2000 Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20,  ...
mixl1 GENE 20 3.9 cM Kikuchi et al., 2000 Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20,  ...
14p1500 RAPD 20 14.81 cM Lee et al., 1998 Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers.
9ae.550 RAPD 20 Lee et al., 1998 Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers.
12f580 RAPD 20 Lee et al., 1998 Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers.

OTHER MAPPING INFORMATION
Genomic Feature ta72a is an allele of bmp2b
Marker Type Chr Distance Publication / Person Comments
z536 SSLP 20 12.5 cM Mullins, 1999
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 160 36.0
Forward Primer GCTCAGCCCTATCTCACTGC
Reverse Primer TTTCTTCCTCCAAAATAGCTCG
Genomic Feature tdc24 is an allele of bmp2b