ZFIN ID: ZDB-GENE-980526-474

Mapping Details

Gene Name:	bone morphogenetic protein 2b
Symbol:	bmp2b

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	20	49,238,332 - 49,244,387	GRCz12tu
NCBI Map Viewer	20	49,238,332 - 49,244,387	GRCz12tu
Ensembl	20	45,893,173 - 45,899,149	GRCz11
NCBI Map Viewer	20	45,893,152 - 45,899,149	GRCz11
UCSC	20	-	GRCz11
Vega	20	45,989,453 - 45,995,429	GRCv10

Mapped Clones containing bmp2b
CH211-213I16	Chr: 20 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	Citations
ihb986	20	45,898,452 - 45,898,456	GRCz11	DIRECT	Zebrafish Nomenclature Committee
sa18243	20	49,241,277	GRCz12tu	DIRECT	Sealy et al., 2025
	20	45,896,039	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	20	45,992,319	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	20	46,429,654	Zv9	DIRECT	Busch-Nentwich et al., 2013
ta72a	20	45,898,787	GRCz11	DIRECT	ZFIN Curated Data
tc300a	20	45,898,583	GRCz11	DIRECT	ZFIN Curated Data
tdc24	20	45,895,886	GRCz11	DIRECT	ZFIN Curated Data
zf3958	20	45,898,287 - 45,898,297	GRCz11	DIRECT	Wu et al., 2022
bmp2b_unspecified	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ta72a	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tc300a	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tdc24	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data
umo34	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data
zf3705Tg	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data
zf3958	20		GRCz11	OTHER_MAPPING	ZFIN Curated Data

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
20	176.7 cM	bmp2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
20	720.06 cR	bmp2b	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
20	3812.0 cR	bmp2b	Goodfellow T51 (T51)	Geisler, Robert	Data
20	116.8 cM	bmp2b	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
z13626	SSLP	20		Kikuchi et al., 2000	Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20, ...
z20046	SSLP	20		Kikuchi et al., 2000	Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20, ...
mixl1	GENE	20	3.9 cM	Kikuchi et al., 2000	Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20, ...
14p1500	RAPD	20	14.81 cM	Lee et al., 1998	Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers.
9ae.550	RAPD	20		Lee et al., 1998	Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers.
12f580	RAPD	20		Lee et al., 1998	Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage group 20 using RAPD markers.

Genomic Feature ta72a is an allele of bmp2b

Marker	Type	Chr	Distance	Publication / Person	Comments
z536	SSLP	20	12.5 cM	Mullins, 1999

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	160		36.0
Forward Primer	GCTCAGCCCTATCTCACTGC
Reverse Primer	TTTCTTCCTCCAAAATAGCTCG

Genomic Feature tdc24 is an allele of bmp2b