Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ta72a

ID
ZDB-ALT-980203-1335
Name
ta72a
Synonyms
  • A72A (1)
  • dta72 (1)
  • ta72 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (2)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
Semidominant allele.  It is likely that the penetrance of the dominant phenotype is dependent on the genetic background, as in our recent generation of fish that had undergone several outcrosses, almost no dominance is observed. Mullins et al. 1996
The termination codon is altered into a tryptophan (TGA->TGG). The next stop codon is after 18 nucleotides, resulting in a mutant protein with an additional 6 amino acids at the carboxy end.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 45898787 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
Semidominant allele.  It is likely that the penetrance of the dominant  ...
The termination codon is altered into a tryptophan (TGA->TGG). The next stop  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G (1)
Transcript Consequence
Stop Loss (1)
Protein Consequence
Elongated Polypeptide: Stop>Trp (1)
Sequences
Flanking Sequence
GAGAGCAACCGGAGGAAGCACGTGAGGGTCAGTCGTTCCCTTCACGCGGATGAGGACTCGTGGGCACAAGCCCGACCTCTGCTGGTAACCTACAGCCATGACGGTCAAGGCACAGCCGTCTTGCATTCGAACCGAGAAAAGCGGCAGGCTCGACGAGGGCAAAAGCCGAGGAGAAAGCACCACCAGCGCTCGAACTGTAGGCGACATGCTCTCTATGTGGACTTCAGTGATGTCGGCTGGAACGAGTGGATCGTGGCACCGCCAGGCTATCATGCTTTCTACTGCCATGGCGAGTGTCCGTTCCCTCTGCCGGACCATCTAAACTCCACCAACCATGCCATTGTCCAGACGCTGGTGAACTCGGTCAACTCCAACATTCCCAAAGCCTGTTGCATCCCGACGGAGCTCAGCCCTATCTCACTGCTGTACCTGGACGAGTACGAGAAGGTCATTCTTAAAAACTACCAGGACATGGTGGTGGAGGGCTGCGGTTGCCGATG
A/G GAACAATCTCCCCAATGAAGACTTTTATTTATACAAAAGAGCGAGCTATTTTGGAGGAAGAAAAGAAATATATATGAATATATTTATGTTGAATGAACAAAACAAAAAAAATGGGAAAATAAATATTTTAATGAGAGTGCTTGCTTTTTCCAGTGGCTTCGAAGATGATTTTTTTTCTTGCCCCATTCCAAAACAAGTGCAATGGCACATGAAGTATAATGCTCAGATTTTTATGATGTATTTATTGCATAACCACTTTATTTGTAAATGTGTATTTATCATGAAAAAATATATGATCTTCATTCAGTGTGCATTTGGGAATACCTTATTTGATACCAAAAAAATAAACAATGGATGATGAAGTTCTCTTTAAAAAGTCATGATATAACATGCTGAAGGCATATTAAAAATCTATGCATTAATAGATTTTAGACATTTGTTATCATGCATGATATGTAATTTTTTTTTACAATAATTAGCAAAAATTTAGGATGACTTTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
ta72a.pdf
Citations