ZFIN ID: ZDB-GENE-980526-416

Mapping Details

Gene Name:	wingless-type MMTV integration site family member 2
Symbol:	wnt2

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	18	22,001,973 - 22,025,257	GRCz12tu
NCBI Map Viewer	18	22,001,973 - 22,025,257	GRCz12tu
Ensembl	18	20,613,241 - 20,636,549	GRCz11
NCBI Map Viewer	18	20,613,241 - 20,636,525	GRCz11
UCSC	18	-	GRCz11
Vega	18	20,624,175 - 20,647,483	GRCv10

Mapped Clones containing wnt2
DKEY-270I2	Chr: 18 Details
CH211-238N5	Chr: 18 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
hu2847	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
hu2848	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
18	77.7 cM	wnt2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
18	1579.0 cR	wnt2	Goodfellow T51 (T51)	Geisler, Robert	Data
18	63.6 cM	wnt2	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
unp279	STS	18	18.0 cR	Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
cbfb	GENE	18	33.0 cR	Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
mef2aa	GENE	18		Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
z4755	SSLP	18		Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
z13426	SSLP	18		Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
z5479	SSLP	18		Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
unp4	STS	18		Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.
unp140	STS	18		Blake et al., 2000	Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	260	Dpn II	36.0
Forward Primer	GGGGCTACGACACATCAAGA
Reverse Primer	CAAAACAGCGAATAAAGACGG

Genomic Feature hu2848 is an allele of wnt2