ZFIN Mapping: st20

ZFIN ID: ZDB-GENE-980526-404

Gene Name:	forkhead box A2
Symbol:	foxa2

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	17	45,937,976 - 45,940,416	GRCz12tu
NCBI Map Viewer	17	45,937,976 - 45,940,416	GRCz12tu
Ensembl	17	42,565,998 - 42,568,498	GRCz11
NCBI Map Viewer	17	42,565,998 - 42,568,438	GRCz11
UCSC	17	-	GRCz11
Vega	17	42,290,592 - 42,293,092	GRCv10

Mapped Clones containing foxa2
DKEY-208C12	Chr: 17 Details

PHYSICAL MAPPING

Feature	Chr	Assembly	Source	DetailedSource
tv53a	17	GRCz11	GENERAL_LOAD	load data [singleton]
st20	17	GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	17	GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	17	GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	17	GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	17	GRCz11	OTHER_MAPPING	linkagesDirectMem1
	17	GRCz11	OTHER_MAPPING	linkagesDirectMem2
tv53a	17	GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	17	GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	17	GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	17	GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	17	GRCz11	OTHER_MAPPING	linkagesDirectMem1
	17	GRCz11	OTHER_MAPPING	linkagesDirectMem2

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
17	165.0 cM	axial	Mother of Pearl (MOP)	Postlethwait, John H.	Data
17	333.51 cR	foxa2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
17	4132.0 cR	foxa2	Goodfellow T51 (T51)	Geisler, Robert	Data
17	98.8 cM	foxa2	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
tv53a	Feature	17		Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped mol^tv53a to LG17 at the same position as foxa2.

Chr 17

Norton et al. (2005, Development 132(4):645-658) mapped mol^tv53a to LG17 at the ...

Markers Encoded by foxa2
fe05g04 Chr: 17 Details
tdsubc_2g8 Chr: 17 Details

Genomic Feature st20 is an allele of foxa2

Marker	Type	Chr	Distance	Publication / Person	Comments
z9830	SSLP	17	5.0 cM	Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped mol^st20 to LG17 using SSLP markers.
z21703	SSLP	17	5.0 cM	Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped mol^st20 to LG17 using SSLP markers.

Genomic Feature tv53a is an allele of foxa2

Marker	Type	Chr	Distance	Publication / Person	Comments
z21703	SSLP	17	2.0 cM	Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped mol^tv53a to LG17 using SSLP markers.
z21194	SSLP	17	9.0 cM	Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped mol^tv53a to LG17 using SSLP markers.
foxa2	GENE	17		Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped mol^tv53a to LG17 at the same position as foxa2.

Genomic Feature tv53a is an allele of foxa2

Chr 17

Norton et al. (2005, Development 132(4):645-658) mapped mol^tv53a to LG17 at the ...

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	454	Tsp509I	36.0
Forward Primer	GACATACGAGCAAGTGATGCA
Reverse Primer	GCGAAAAAAGTCCAAATAACA

Mapping Details