Transcript

lamc2-004

ID
ZDB-TSCRIPT-141209-2567
Name
lamc2-004
Previous Names
  • dkey-161l11.2-004
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032751 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032751|OTTDARG00000017020|ZDB-GENE-110222-3 lamc2|no_translation DKEY-161L11.2-004 LG_ BX681417.10 Danio rerio protein_coding NOVEL, 608 bp
GTCGCTAGTTTACTTTTTAGGCAAGACACCGGACATGAGA
TTTGTTAACAACAGACACCATTATAGATTTTAAGCCTCCT
CTGCCTGTTCATGCCATGGGAAGGCACGGTTCTGCAGAGC
AGATCAGCTGGGATTGTACTGTTTAAACTGCCAGGGAAAC
ACCCAAGGGAGGCATTGCGAAAGCTGTAAGGAAGGATACT
ACCACCAGAGGGCAGGAGACAATTGTGTGCCCTGCAACTG
CAACCCTGCAGGTTCTCAAGGACCTGTCTGCAGCAGTAAT
GGACAATGCACATGTAAACAGGGAATTCATGGAGACAAGT
GTGACCGCTGTCATGATGGTTCTCCAGTCACTGCCAACGG
ATGTGAGCCTTTAAGGCTAAGGTGTTGGTCGCGTAACAAT
GGCCGTCTCACATATAATACAGAGGAGTGTCTTCCTTGCT
TTTGCAATGGCCACTCAAATGTGTGCAGCTCAGCTGAAGG
GTATTCCGTTTACAACATCACTTCACCTTTTGAAAATGGA
CCTGAAGGGTGGCGAGCAGCAACTGCTCAAGGTGTGAACC
CTTCACAAGTGCAGTTCAGGTGGTCTCCTACTCACAAAGA
CCTTGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations