Transcript

lamc2-203

ID
ZDB-TSCRIPT-141209-127
Name
lamc2-203
Previous Names
  • lamc2-003
  • dkey-161l11.2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032752 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032752|OTTDARG00000017020|ZDB-GENE-110222-3 lamc2|OTTDARP00000026500 DKEY-161L11.2-003 LG_ BX681417.10 Danio rerio protein_coding NOVEL, 756 bp
ACGCTGTGGGCAACTGTGACCGGCGAACAGGGCAGTGCCG
GAAGTGCCTGAACCACAGCACTGGCCCCAACTGTGAATAC
TGTGAAGCTGGATACCACCACAACTACCCCACAGAGCCAT
GCCAGGCTTGTAACTGCAACCGACAGGGTTCTGTGTCCAA
TTCATGCAGTGATAAAGGCCAGTGCGAGTGTAAGGAAGGA
TATGATGGACTTAGGTGTGAAGAATCAACATGTCCATCCT
GCTTTAATCCAGTTAAGAGCAAGATAGAGGTCTATGCACG
CCAGCTGCAGGAAATGGAGGATTTATTTAAGGGATTTGGA
GGTAATGAAGCTCCGGTCAGCGATGCTCAGATGGACCAGG
CTGTTCGGGCAGCAGAAGTCATGGTCCGAAACCTGGAGAG
CAGAGCAAACGAACTCACAAACACGGAGAAACAGCTTCAG
GATAAACTGGCGAGCATTAGCCGATCTCAGCTGAGGGAGG
ATAGAAACATGGAGGCTTTGTTGACAAGCGTGAATGGGAT
CAGAAACAATGATCAACAGTACAGGACAGAAGTTTCCGAA
ATCCGTAAACTCATCAGTGACGTCAGGTCAAAGCTGCAGC
AGGCCAAACGGGACATGCAGGAGATTGAGATTCCCTCAGG
TGATGCTGTGCCAGGCTCTGGCACCTTGTCTGATCTGGTT
CAGAGAGCTGCTGATCTTGCTGAGCAGCACCAGGGTGAAG
CATTGACGGTGGAGGGCATTGCAGACAATTCTCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations