Transcript

lamc2-202

ID
ZDB-TSCRIPT-141209-2481
Name
lamc2-202
Previous Names
  • lamc2-001
  • dkey-161l11.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020503 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020503|OTTDARG00000017020|ZDB-GENE-110222-3 lamc2|OTTDARP00000017317 DKEY-161L11.2-001 LG_ BX681417.10 Danio rerio protein_coding NOVEL, 1406 bp
AGCGGAGAGGCTCAGAATGCTCTTCAACAGTTATCTGACC
TGGAGAAGAAACTTCCAAAGCCTCTCACGAAGGAGATTGC
TGGTGTGGTTTCCATGTTCGATAATCTGAAGGGTCTGGTG
GAGGGAAACCTATCGCAGTACAGTGACCTACAGCAGTATA
TGCTCAATGAGCAGAAAGAGACAGGGGATCTGTTAATCAA
GGCCAAGAATTTCCAACAGATTCAAGACGAACTTCTTGCC
AGGGCAAATGCAGCAGAAGCAGTCAAAAATCAATCTCTGG
AAATCTTTGCCAACAACAAGGATAGCCTGGAGAAGACACT
AGAGACACTCAAAGGATTTGATGATCAGATTGGTGTTAAG
AAGGATTTGGCAGACGCCGCCATCAGTAAACTTCCAGCGG
TCAATGCCACCATCCAGAAGGCCATCGCTGACAACATGCA
GACTCAGGACATTCTGGACGCAATGGCTGATCCCTTTAGG
GACGCTCAGGAAACCATCGACACTCTCACAAGCAATGTAT
ACAAACTAGAGGGCATGACCAGTTCTCTTCCGTCTTCCTC
TGATATTTTGGAAGCTGCCAGTAAGCTGAAAGAGGATGTG
GATGGACTGAAGACAGAAGCGTCTGCAACGAGGGACAGAC
TGAATGAAGAGAAAAGCAAGGCAAAAGCACAGATAAATGA
AGCCAAGAACGCTGTCGTGGAGTCCAATGGGGTACTTGAA
AACGCAAAGAAAGCCAGGAACGCAGTTAATGATACTCTAC
AGGACATCGCTGATATTATGAGCTCACTCGGAACTCCTGG
TACCATCGATGACAAACGAGTGGCCGACTTGGAGAACGCC
ATCACTAAAAGCCGCAGACGTGTGGAGGACGAGCTGAGGC
CTAAACTTAGGGAACTGGAGGCGAAGGACGCCCAGCAGAG
AGCCACCATTACAGGCATGATCAATGACATTGACACCATT
CTGGCTGACATCGCCAACCTTGAGGAGATCCATAAAAACA
TTCCTGAAGGCTGTTTTAACATACCACCTATTGAAAGGCC
ATAAAGGGTTAAAGCAGGAAAAATGACAATGTTACATAAC
CTATGAACTTATCAACACCGCTTTTCATCTAAAGAGTGTT
TTTCGGCGCTAACGTGTGAGAGAGTTTTTTAGTATTTATT
TTTTGTTGAATTTTTAAAAACAAATTATTACTGTGAAGTT
TGAAATGAGATGAATTATATTTCTGTTTTGCATTATTACC
CAAGATAATTCCGTTTCAGATTAATAGATCAATACCAGAA
CCACATCTAAAATTCATTTTTATTTACCATTTTCAACGTC
TATCAAAAAAAGTTTACAATTGTGAAAGAAATGCACAAAC
TAACACCCTTCATTATTTTGTGATCCTTTTTGTTTTATTA
AATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations