header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1491
Transcript Name: ottdart00000059698
Previous Name: dkey-19j7.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059698 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059698|OTTDARG00000041398|ZDB-GENE-030219-193 aff3|no_translation DKEY-19J7.5-001 LG_ BX649266.9 Danio rerio antisense NOVEL, 716 bp
CTCCATTCTCAGCCTATGACAAACACACACAAAGAATACA
GGTGGTTGGTCAGAGTGGTTCAGATGCTTCATTGATGACT
TTTCTTTTGCCTTTCCCGATGACACAGATGAAGACGAAGA
CTGTCTCTCTGTAAGCTCATCTGCACTCGGGACCCTACCC
AGAAGACAGAGGTCTATCCTCACAACTAGTTTTTTCAGGC
CTCGATGAGGGATGGTGGGGGACTTTTCAGTCCGGCCAAA
AGGAACGAGTGTATAGAGTTTGTGTCTCCCCCGACTGTGT
TTTTCTGTTTCAGGGGTACTTAAGCAGGACCTCTCGGGGT
GACTACTTGAGCCTGAATTTTGTTTCTCATGCCTGCTCTT
TGATACAGTTTTTTTGTTTGATGTTGAATCTGCAGGGACT
TTCGCAATGTTCCTGGGTGGACTAGACTCAGAGTCTGATT
CAGAGGAAGATGATGAGGATGAAAAGGAAGATGAGGATGA
AGAAGATAATGGATGGGTGGGCTTGACGACAGGAGTAGGG
GTAGGTGGAGAGAGTGGAGGAGAAGGGCTAGAGTCTGTCA
CATAAGGACGTGAGGAAACGTCTCCGTTACTCCACCGTCT
CTTCTTCCTCCTCTGCTCCTCAAGGTTGGGTCCATTGCAT
TCCCTTTGTGTGTGATGCTGGCTTGTGTGAGGTCTTTGTT
TGGGCTGAACTGCCCTCCATTCAGCTTCCGGTTCCC

aff3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aff3-201 (1) 540
aff3-202 (1) 4342
antisense ottdart00000059698 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000059698 Contained in:
OTHER ottdart00000059698 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059698 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)