header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15336
Transcript Name: aff3-201
Previous Names: aff3-002, si:dkey-19j7.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034554 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034554|OTTDARG00000026108|ZDB-GENE-030219-193 aff3|OTTDARP00000027846 aff3-002 LG_ BX649266.9 Danio rerio protein_coding KNOWN, 540 bp
CTCTGGTCAGCTACTGGAGGCGAGCAAGCAGGGAAAGCAG
TCTGCCCTGGAGCTCAAGAGAGCTATCAAACGGAAAGTCC
TCCATCCACCCATTGGCAGTTGGACAGATGGCTTGAGAAA
GTACCTAAAAAGCATCAGTCCACTGACTACAATCCAGGAG
GAGGACACAGACAGAGTGCAAAATCTGACTGTGATCGTGG
ACCATCTCCTGGAAGATACTGGAGCAGAGAATCTGAATCA
AGACGGGATTATAGTCCATGTGGAAGTCAAGTCCCAAGTC
CAAAATTTGACTATAGCCCCAGAAACAGTCCTCATCCCAG
CCCAGGATACAGTCCATGCCCCAGTCCAGGAAATAGCCTT
GTGCAAAGCCCAGTGCCAAGTGTGTGCCCAAGTCCAGGAG
ACAGCCTCCAGGGGAGTCGAAGTCCCAGCCCTTTACCAAC
ACACCCTCCCAGAAGCCCCAGTCCAAGTCTCTTATCCAAA
GCAGTACCCAGCCAAGGTATATATTCTCAGGTGCAGACAT
CTCAACAAGAAAGTCCCAGG

aff3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aff3-201 540
aff3-202 (1) 4342
antisense ottdart00000059698 (1) 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aff3-201 Contained in:
OTHER aff3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034554 (1)
  • Ensembl_Trans:ENSDART00000131634 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL914139 (1) 539bp
    GenBank:EB778596 (1) 181bp
    GenBank:EB781715 (1) 105bp
    CITATIONS (2)