ZFIN ID: ZDB-TSCRIPT-090929-15335
Transcript Name: aff3-202
Previous Names: aff3-001, si:dkey-19j7.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034553 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034553|OTTDARG00000026108|ZDB-GENE-030219-193 aff3|OTTDARP00000027845 aff3-001 LG_ BX649266.9 Danio rerio protein_coding KNOWN, 4342 bp
AGGGAAAACAACCCAGTGGACGACAAAGACATGCGAGGGA
CGGTGTGTCTATGAGGATGCCCTCACGTCCACTCGTGGCC
CCTCATAAATCCATGCTGGCTGATGACCTAAAGCTCAGCA
GTGACGAAGATGACAAGGACGAGGGAAGCGAGCAAACAAC
TTCCTGGGCTGATAATGACCGCTTGTCAACCCAGCACCAG
CAGCAGCAGCAGCAACACCACACACACACACATGCCGGAA
GGGTGAGACATTCTAGCTCGGGGTCTTCAGGAACAGACCG
CTCCAGCGATTGGGAAAGCAGCAGTCAACGTTCCCGCAGC
CCAAGTCCAGGGGCGCACACCCGGTGTGGGACCCCGACCC
AACAGCGAACCTTGAACTGCAGCACTGAGACGGAAAGTCC
TCCATCCACCCATTGGCAGTTGGACAGATGGCTTGAGAAA
GTACCTAAAAAGCATCAGTCCACTGACTACAATCCAGGAG
GAGGACACAGACAGAGTGCAAAATCTGACTGTGATCGTGG
ACCATCTCCTGGAAGATACTGGAGCAGAGAATCTGAATCA
AGACGGGATTATAGTCCATGTGGAAGTCAAGTCCCAAGTC
CAAAATTTGACTATAGCCCCAGAAACAGTCCTCATCCCAG
CCCAGGATACAGTCCATGCCCCAGTCCAGGAAATAGCCTT
GTGCAAAGCCCAGTGCCAAGTGTGTGCCCAAGTCCAGGAG
ACAGCCTCCAGGGGAGTCGAAGTCCCAGCCCTTTACCAAC
ACACCCTCCCAGAAGCCCCAGTCCAAGTCTCTTATCCAAA
GCAGTACCCAGCCAAGGTATATATTCTCAGGTGCAGACAT
CTCAACAAGAAAGTCCCAGGCATATTTCACGGCCAACAGT
TGCCTCCAATTCAGGACATCATCCCAAAGTCAGGCCATGG
GTGCCTCCGGACCATAACGCTAACCAGAGAAAAGAGTTAA
GAGCCAAAGATTCTCGATCCAAAGACTCTCAGTCTAAAGA
CTCCAGACCTGGTCCTCAACATCAACCATTTAATTCCAAA
CACGGCTCAACAGAAAGGTCACACAAAGATTTCACACACA
AGCCTGAAGCCAAAAACTCTGAATCCACAAGAAAGCAAAG
GTTTAACTCACCTTCAAAAACTGTTTCAAAGCATCCGCTG
CAGCAAAGACCCAGCATTAGCCCAAAACCTCAAGCCAGAA
CCTTATCTACAGTTGATCATAGTAGTGAATTTAATCACAA
AAGCAATGAGCCCACAGCAGTGCCAGTCCACAATTCAACC
TCCAAATCAGGGCATTCATCTCATTTTAGTATTTTAAAAA
GTTCTGAATGTGGTCCCTTGTCAAAGTTCAAGGACTCATT
GCAACGTGAAGCGAACAGTCGATCAAGTCACAGCTCAAAA
AATAAATCTTTCCCCGATACCAACCGATCCAGCTCAAAGC
AGACTTCCCAATCAAGCTCCAGCCCAAAACCCAGGCCCAA
ACTAGAGGACAGCTCAGTTCCCAGAACTGGGCACTCCCAA
AAAGAGCCAAAACCCAGAGAGAGAGATCGGGAGGTGGACA
GCCGAGGTAGAGCCCAGGGAGTGAACCTGGTGCCAACCGG
CAAGGAGCAGAGACATAGAAGACTGGCGGAGGAGCAGGTA
ATAAGGCGCCGCTGGGTTCGGAGTTCTGAGGAAGAGGAAG
GTGAGGAAGATAAGAGAACTGAGGAAGGGGAAAGAGAGAG
GAAACGGAGAAGGAGGAGGGAACCGGAAGCTGAATGGAGG
GCAGTTCAGCCCAAACAAAGACCTCACACAAGCCAGCATC
ACACACAAAGGGAATGCAATGGACCCAACCTTGAGGAGCA
GAGGAGGAAGAAGAGACGGTGGAGTAACGGAGACGTTTCC
TCACGTCCTTATGTGACAGACTCTAGCCCTTCTCCTCCAC
TCTCTCCACCTACCCCTACTCCTGTCGTCAAGCCCACCCA
TCCATTATCTTCTTCATCCTCATCTTCCTTTTCATCCTCA
TCATCTTCCTCTGAATCAGACTCTGAGTCTAGTCCACCCA
GGAACATTGCGAAAGTCCCTGCAGATTCAACATCAAACAA
AAAAACTGTATCAAAGAGCAGGCATGAGAAACAAAATTCA
GGCTCAAGTAGTCACCCCGAGAGGTCCTGCTTAAGTACCC
CTGAAACAGAAAAACACAGTCGGGGGAGACACAAACTCTA
TACACTCGTTCCTTTTGGCCGGACTGAAAAGTCCCCCACC
ATCCCTCATCGAGGCCTGAAAAAACTAGTTGTGAGGATAG
ACCTCTGTCTTCTGGGTAGGGTCCCGAGTGCAGATGAGCT
TACAGAGAGACAGTCTTCGTCTTCATCTGTGTCATCGGGA
AAGGCAAAAGAAAAGTCATCAATGAAGCATCTGAACCACT
CTGACCAACCACCTGGAGATGGCAGAAGTAAAAGAAAGGC
TGAGAATGGAGACCTTCAAAGAGAGAATAAGAGAAATCAC
TCGTGTACAGATAAACAACCATCATCAGTCCATCATGAGA
CAGAGGAAACCTGTGTGGACAATCAACAAAACGGATGTCA
GGATGATTACTTTTACTCCAAGAGGCCAGTGTCCCCATTA
TCTCCTCCGTCTAACATACTGGAGCTCTCAAAGCACTCTG
TGAAAGCTCAGCATGCAGAGAAGTACTACACACCTCCAGA
AAAAGACAATGATTCAACAGCACAGAAAACCCAGATCCAA
AAGACGCAGCCCAAGGTAGAGGTGGAATGTATTGGGGTGT
CAGGACATCTACAACCTCTCTCTGGATCGAGGGTTCCTCC
CCCAAACCTTCCTCTTCACTACAGAGGAACAGTACCTATT
AGTGATGTCTCTCATCATGCTGAGTATTATATGCATGAAG
CCAAGAGATTGAAGCATCGAGCAGACGCTATGGTGGATAA
GTTAGGAAAAGCTGTGAATTATGTGGATGCTGCATTGTCT
TTCATGGAATGTGGTAAAGCCATGGAAGAGGGACCACTGG
AATCCAAGTCTCCATACACCATGTATGCTGAAACGGTTGA
GCTCATAAGATACGCTATGAGACTAAAGAGCCACGCAGGG
CCTGGAGCCAGTCAGGAAGACAAACAGCTAGCTGTACTAT
GTTTCCGCTGTCTTGCTCTTCTTTATTGGCAAATGTTCAG
ACTTAAAAAAGACCATGCCCTGAAATACTCTAAAGTCCTG
CTAGACTACTTCAAGAGTTCTCCAAAAGGACCTCACAACC
CCCCTACAAGGAACGATTCTGGAAAAGGAACTATTCCTCC
AGCCTCTATTTGCTCTGTCAGTATAATGGGATCTCACACA
GGCAAATCACCAAGCACAGTCATAAGCATTCCACATCGCA
TCCACCAGATGGCAGCAAATCACCTCAACATCACCAACAG
TGTCCTGTACAGTTACGAGTACTGGGAGGTGGCTGATACG
CTGGCCAAGGAGAACAAAGAATTTTTCAACTATCTGAACA
CGCTGACTGGACCGTTGACTCTGCACAGCAGCATGGCTCA
CATCGTTCAGTACACCAGGCAAGGGCTCCAATGGATTCGG
ATCAGTGCTAATCTGTCATAATACCATGTACAGACATTTA
AAATCTTCACAAATCACTTTTGGAAACAATGTTTTGAAGC
CAAACAAGCAAAACATTTTACAATTACCTGCATTCTGTGA
AATTAAAAATGGCCTAGGGTCAAGGTGGAGAACTGACTGC
CATAGATTTACAACTGTTTCAAGTTAGGTGACTTCATGTC
ATTTACTTTACTTTCCTTGTTACTTTACATTTGCTGAGCA
TTAAATGTGAAAATATCCGAGGACAGAGTGTCAGAAATAA
TCATGTTTACTTAAATGTCATCAAAACTTGCCGTTGAGAT
TGAAAAATTCAATCATTCAATTCTTAGAACTTGTGTAGCG
TGCTAATCTTATTGAAGGTTTTGAAAAGGTACTGTTTTCC
GCTAATTTAACTAATGCTGCTTTTCCAAAATGTGCCACGT
TTTATATAAAAAAATGTCAGGGTGTTGCATTCATCTTTCA
TGTTTTTTATTTTTGTTTTACATGAGCCTTTCATAGCTTC
TTAATGTAAAAATCAGTGCATGCACAAAGTCTCTTCAGAT
CTGTGGATGTGATTCATGTTTTTTACAAAGTTCTTTGTGC
AATAAGTCTGAATTTTACATATGTGTTATGTAGATGTTTT
GGTGCTGTTTTTCAATAGCCAGCATAAAGTCATACCAGTC
TATGCAAGACTGTAAATGGCATTGTGAAGTTGTTGTAAAT
TTGAAATGTAAGATTGACAAACACAGTCAGGACTTTTATA
ATTAAAAGGATTTTACAGTAAA

aff3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aff3-201 (1) 540
aff3-202 4342
antisense ottdart00000059698 (1) 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aff3-202 Contained in:
OTHER aff3-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034553 (1)
  • Ensembl_Trans:ENSDART00000137922 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE315188 (1) 865bp
    GenBank:EB773087 (1) 395bp
    GenBank:EB774425 (1) 388bp
    CITATIONS (2)