Transcript

prdx1-003

ID
ZDB-TSCRIPT-130528-503
Name
prdx1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058978 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058978|OTTDARG00000019363|ZDB-GENE-050320-35 prdx1|no_translation prdx1-003 LG_none AL954171.10,CU467854.31 Danio rerio protein_coding KNOWN, 627 bp
CAGAAAATGGCAGCTGGAAATGCACACATTGGGAAACCTG
CTCCGGATTTCACAGCCAAAGCAGTGATGCCTGATGGACA
GTTTGGAGATGTCCGTTTGTCTGACTACAAAGGGAAGTAT
GTGGTGCTGTTCTTCTATCCACTGGATTTCACCTTTGTCT
GTCCCACTGAGATCATCGCCTTCAGTGATGCTGCCGAGGA
GTTCAGGAAAATCAACTGCGAGATCATTGGTGCTTCTGTC
GATTCCCACTTCTGCCATCTTGCCTGGACCAAAACACCCC
GAAAACAAGGTGGTTTAGGACCAATGAATGTCCCTCTGGT
GGCAGATACTCTCCGCTCCATTTCTAAAGACTACGGTGTA
CTTAAAGAAGATGAGGGTATTGCATACAGGGGTCTTTTCA
TTATTGACGACAAGGGCATTCTGCGGCAGATTACCATCAA
CGATCTGCCAGTCGGTCGCTCCATTGATGAAACCCTGCGC
TTGGTGCAGGCCTTTCAGTTCACCGATAAGCATGGAGAAG
GTAACACTTTCTCATCTCTGACCTGATTCCATGTAACATT
CCTTTTTCATACTGTACAGTGTCTACAATCAGAGGTAAAG
GGGAAATGAATTACATACATGAGTATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations