Transcript

prdx1-202

ID
ZDB-TSCRIPT-130528-249
Name
prdx1-202
Previous Names
  • prdx1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058977 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058977|OTTDARG00000019363|ZDB-GENE-050320-35 prdx1|OTTDARP00000046059 prdx1-002 LG_none AL954171.10,CU467854.31 Danio rerio protein_coding KNOWN, 933 bp
AGGCTGCTTTTGGAAGGAGAGTTTCATTTTTGAAAATGGC
AGCTGGAAATGCACACATTGGGAAACCTGCTCCGGATTTC
ACAGCCAAAGCAGTGATGCCTGATGGACAGTTTGGAGATG
TCCGTTTGTCTGACTACAAAGGGAAGTATGTGGTGCTGTT
CTTCTATCCACTGGATTTCACCTTTGTCTGTCCCACTGAG
ATCATCGCCTTCAGTGATGCTGCCGAGGAGTTCAGGAAAA
TCAACTGCGAGATCATTGGTGCTTCTGTCGATTCCCACTT
CTGCCATCTTGCCTGGACCAAAACACCCCGAAAACAAGGT
GGTTTAGGACCAATGAATGTCCCTCTGGTGGCAGATACTC
TCCGCTCCATTTCTAAAGACTACGGTGTACTTAAAGAAGA
TGAGGGTATTGCATACAGGGGTCTTTTCATTATTGACGAC
AAGGGCATTCTGCGGCAGATTACCATCAACGATCTGCCAG
TCGGTCGCTCCATTGATGAAACCCTGCGCTTGGTGCAGGC
CTTTCAGTTCACCGATAAGCATGGAGAAGTTTGTCCAGCC
GGATGGAAGCCTGGAAAAGACACTATTAAGCCCGATGTCA
ATCAGAGCAAAGACTTCTTCTCCAAGCAAAATTAAAACTA
AAAAAGGCACTAGACTCTGCAGCATAGTATAATAGACAGA
AGTGATGTGAATTAATGCTACTGGTTGGACTAGTACATCC
ATTTACAGGTGGTTATTCTTATTATATAGTGTTATATATT
GTAAAGTTGTAGGACTAAAGTGTGTCAGACTACCTGAAAT
GTATTGAACCGTTTGAGTTGGTTTGTTCAACTTTGTCTTA
CCATTTAGTTTTGTGTGAAAAGAGATGTTTTATAGCGATG
ACCTTCTGACTACACTGTCAACAATTGCATTTCAAATAAT
AAACTCGTATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations