Transcript

prdx1-201

ID
ZDB-TSCRIPT-090929-6727
Name
prdx1-201
Previous Names
  • prdx1-001
  • zgc:110343-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023759 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023759|OTTDARG00000019363|ZDB-GENE-050320-35 prdx1|OTTDARP00000019704 prdx1-001 LG_none AL954171.10,CU467854.31 Danio rerio protein_coding KNOWN, 1224 bp
AAGTCATGCTGCCATAAACACTTCTCTGTAATTTGGTCTT
TCCACGGAGCATTTACTCCTCGGAGCAGCGCATCTTGCAG
AGTATCGCGAGACTTGAGCACGACCTATTTAAACACCAGC
CGCTGCCCGCGAGTTCACTTTCATTCATTCACTCTCGGAT
TGTGAAGACAGTTCAAGAAAATGGCAGCTGGAAATGCACA
CATTGGGAAACCTGCTCCGGATTTCACAGCCAAAGCAGTG
ATGCCTGATGGACAGTTTGGAGATGTCCGTTTGTCTGACT
ACAAAGGGAAGTATGTGGTGCTGTTCTTCTATCCACTGGA
TTTCACCTTTGTCTGTCCCACTGAGATCATCGCCTTCAGT
GATGCTGCCGAGGAGTTCAGGAAAATCAACTGCGAGATCA
TTGGTGCTTCTGTCGATTCCCACTTCTGCCATCTTGCCTG
GACCAAAACACCCCGAAAACAAGGTGGTTTAGGACCAATG
AATGTCCCTCTGGTGGCAGATACTCTCCGCTCCATTTCTA
AAGACTACGGTGTACTTAAAGAAGATGAGGGTATTGCATA
CAGGGGTCTTTTCATTATTGACGACAAGGGCATTCTGCGG
CAGATTACCATCAACGATCTGCCAGTCGGTCGCTCCATTG
ATGAAACCCTGCGCTTGGTGCAGGCCTTTCAGTTCACCGA
TAAGCATGGAGAAGTTTGTCCAGCCGGATGGAAGCCTGGA
AAAGACACTATTAAGCCCGATGTCAATCAGAGCAAAGACT
TCTTCTCCAAGCAAAATTAAAACTAAAAAAGGCACTAGAC
TCTGCAGCATAGTATAATAGACAGAAGTGATGTGAATTAA
TGCTACTGGTTGGACTAGTACATCCATTTACAGGTGGTTA
TTCTTATTATATAGTGTTATATATTGTAAAGTTGTAGGAC
TAAAGTGTGTCAGACTACCTGAAATGTATTGAACCGTTTG
AGTTGGTTTGTTCAACTTTGTCTTACCATTTAGTTTTGTG
TGAAAAGAGATGTTTTATAGCGATGACCTTCTGACTACAC
TGTCAACAATTGCATTTCAAATAATAAACTCGTATTTTGT
AAAAGCTTTATTAGTTTATTTGTTACCACTGTTTGATTTG
TAAACATTTATAAATCTTCAGTGCTACATGTTTTTCTTGG
TCTGTTGTTATCGGATGTGTTAAGAGTGTCGTAAAGTAAC
AAATTACAAACACTCTGTACTACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations