Transcript

rbck1-005

ID
ZDB-TSCRIPT-120702-92
Name
rbck1-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056161 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056161|OTTDARG00000009161|ZDB-GENE-040704-3 rbck1|no_translation rbck1-005 LG_ BX324213.8 Danio rerio protein_coding NOVEL, 490 bp
CTTTATTTCAGTCTAATTAAAGTCAACATTAGATTTTACA
TTTATAGTTAGATAGATACATAGATTTAAATACTAAAATA
AAATTATAATAATAAACAAAATAACTTTTTGTTTTTGCTT
TCTTTTTAAACAAGCTTTCAAGATTAAAGTATGGCTGCTC
TTGATGCCTCTAGAAATGTAACGGAAGCGGAGGATGCCGC
TCGACTTCTTAGTGACGCCATCAACTCCAGAGACAAAGAT
GAAGCAACTAAATACCTGAATCAACTTCTGGATCTGAAAC
TCCCAGTGAGCGTCAAAATTAATCCAGATGCATATTCTCA
AGACAACATCAGATTAAGAGTTGGAGTGGCTGATGCTGAA
TCAGAACATCACATCCCAATAACAGTGATGGTACCAGTTT
ACATGACAATATCCGAGCTGAAGGAAAAGATCAACGGTGA
CTATGGCTTCCATCCGTCTCTCCAGCGCTGGGTGATCGGG
AAGCGTCTCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations