Transcript

rbck1-004

ID
ZDB-TSCRIPT-120702-218
Name
rbck1-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056162 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056162|OTTDARG00000009161|ZDB-GENE-040704-3 rbck1|no_translation rbck1-004 LG_ BX324213.8 Danio rerio protein_coding NOVEL, 204 bp
GAGACTTTCCTGACTTCCTTGTGAAGCTTCGTTTCACTTT
TCTTTCCACAAATTTCTGATTGTGACAAGAGCACGGATGG
TTTTATCACCACGTACTATAACCATAAACACAACACGAAG
CGTGTTTTAAACGTTTGTCCTATGGTTGAAATGTAACGGA
AGCGGAGGATGCCGCTCGACTTCTTAGTGACGCCATCAAC
TCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations