Transcript

rbck1-201

ID
ZDB-TSCRIPT-090929-1756
Name
rbck1-201
Previous Names
  • rbck1-001
  • zgc:91964-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010520 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010520|OTTDARG00000009161|ZDB-GENE-040704-3 rbck1|OTTDARP00000009056 rbck1-001 LG_ BX324213.8 Danio rerio protein_coding NOVEL, 2629 bp
GAGCACGGATGGTTTTATCACCACGTACTATAACCATAAA
CACAACACGAAGCGTGTTTTAAACGTTTGTCCTATGGTTG
CTTTCAAGATTAAAGTATGGCTGCTCTTGATGCCTCTAGA
AATGTAACGGAAGCGGAGGATGCCGCTCGACTTCTTAGTG
ACGCCATCAACTCCAGAGACAAAGATGAAGCAACTAAATA
CCTGAATCAACTTCTGGATCTGAAACTCCCAGTGAGCGTC
AAAATTAATCCAGATGCATATTCTCAAGACAACATCAGAT
TAAGAGTTGGAGTGGCTGATGCTGAATCAGAACATCACAT
CCCAATAACAGTGATGGTACCAGTTTACATGACAATATCC
GAGCTGAAGGAAAAGATCAACGGTGACTATGGCTTCCATC
CGTCTCTCCAGCGCTGGGTGATCGGGAAGCGTCTCGCCCA
GGACAAAGAAACCCTTTATTTTTATGGGATCCGAAACCAC
GATGATTCTGCCTTCCTCTTCATCCGCTCTGCTCAGTCTG
TCAATCTGCGCCGCGAACAAGAGAGAAGAGAGAAAGAGGA
GAGGCAGATCGATGTTATAATGGAGACCATTGAACGTCCT
CTTCAACGTCCACCAGAGCGCATCACTAGAGGAAACACTC
GCCCTGCTCTACCTCCAAAACCCAAATTTCTGGATGGTTG
GGCATGTCCTCAGTGCACGTACCTGAATAAACCGACACGT
CCAGGTTGTGAGATGTGCAGCACGGCGAGACCCGACAACT
ATCAGGTGCCGGACTTGTACCAGCCGGACGAGTCTGAAAC
CAGGAGACTACAGCAGGAGGAACTCGCCAGCCTGCAGTAT
GAGCAGTCTCTGTTACAAGAGGAAGAAAGAAATTTCCTTG
AACGGCAGAGGAATTACGAAGAACTCCTGCAAACAGATGC
ACACAGCCTGGTGGGAAACACAGATCAGCTGGAGTGCGCC
ATTTGTTTTGGCACCATCATGCCAGGAGAGGGCGCCGTTT
TAAGAGAGTGCCTTCATAGCTTCTGCAGGGACTGTCTGAA
AGGGACCGTAGTGAACTGCCTGGACGCTGAGGTTTGTTGT
CCTTATGGAGACAACGCTTATGCCTGTAACTGCAAACTCC
AAGATCGAGAGATCAAATCTCTTCTCACTCAGGACGAGTA
CCAAAAATTCCTAGAACTGCGGCTGAATATCGCTGAGTCC
CGCAGTGAGAACAGTTACCATTGCAAAACCCCGGACTGCG
CTGGCTGGTGCATCTTCGAAGATGACGTTAACGAATTTAA
GTGCGACATCTGCAATGAGACCAACTGCCTCCTCTGCAAG
GCTATTCATAAAGGAATGAACTGCAAGGAGTACCAGGACG
ACCTACGTGTGAGAGCGCAGAACGATGAAGCGGCTCGGCA
GACCACAGAGATGCTGGATCAACTGCTAAAGAATGGCGAG
GCGATGAACTGTCCCAAATGTCAGGTGATCGTCCAGAAGA
AAGACGGCTGTGACTGGATCTGTTGTCTAATGTGCAAAAC
CGAGATCTGCTGGGTGACCAAACAAGCCCGATGGGGACCT
TTGGGTGCTGGAGACACATCAGGCGGATGCAAATGTCGAG
TAAACGGAGTCCTTTGTCATCCGCAATGCCAGAACTGCCA
CTAAACACTAGCAAATCGCTAAACGCTACTTCCTCAACAA
GCAAAAAAAAAATGCTACAACAACATAACACTCCATAATG
TGATTTTTGGTTTTTTCAGGTTTCAGGTTTGGCCTTTAAA
ATGATGTATATTCAAATTTTCACTGTCTAGTCTTATAACT
GGTGCATCCCAAAAAAAGGGTGTTTGATTGTTTAAAATGT
TTATAAAATTAATTGTACGTTTACATGACACCATTTGTAA
CTTAATGTGTTTCGGCGCCATGAAAATGCTAACTTTGGTT
TTAAAGTGAACATTATTTTAAAACTATACAATATTTTCAT
CTCGTTAATTTTGAAAATTCGATTCTGTAAAAAACTGTGA
CGTCCTGTGTTAATATTTGTCAGAAAAAAAAAAAGTTACG
TGCTAACTAAAGAACCATATGACCTTATGTTTCTGTATAT
CGCCACCTACTGGTCTGGCATACGAAATACGGCAGTTTTT
GTTATTTTAGAGCAGGGAGCTATCGCAAACGTATGTACAC
AAAATATTTTGTGTTTCTATTATATTTCTGTCATGTAAAC
GTACCCTAAAAGTATATGAGCTTTAATATAAATTTAAAAA
TGCCTCAAATCACTACTGTTTTCTGCTGAACTCATGCTCT
GGGACTTTGTGCAATGAAACCGAAAGAGAAAGAGCTGTAT
TATGTGGTATCTGAATATTAATTTGAAGGGAATCTGTGCT
TAGAATCCAAAGATGTACTTTTTTTTAAATTGACAAATTA
TAGCAAAGGATTCAACATGAATCAATCGATTAAAGAACAA
CAGTTCCATGAAATTGAGAGAAGTTTTATAAAATCCCCAA
AATACTTTATTGCTGATATGTGATGCATATAATCTTGTAG
ATTTATTTTCTATTTTTTTAAAGCATGTGAATGCATTATA
ATTCTGTTTACTGATTTCAGCTTGTTTACAATGTTTTATA
ATCAAATAAAGCTGCTATAAAAAAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations