Transcript

rbck1-203

ID
ZDB-TSCRIPT-090929-1757
Name
rbck1-203
Previous Names
  • rbck1-002
  • zgc:91964-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010521 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010521|OTTDARG00000009161|ZDB-GENE-040704-3 rbck1|OTTDARP00000009057 rbck1-002 LG_ BX324213.8 Danio rerio protein_coding NOVEL, 493 bp
AAACATCTTGTCTGTGTATTTTCTTAGCAAAGAATCGCGT
ACCCAACATCGCAAAAACACTACTTTCATAGTTTTATTTC
TTTATTTAGAGGTAAAAGGGTCAAATTAATGGATTGAGGA
CGAAGAGAGTGAAGAACTTGCAGTGTTTTGCTTCACAACA
CCTCATATCAGGAGCCACAGCTTTCAAGATTAAAGTATGG
CTGCTCTTGATGCCTCTAGAAATGTAACGGAAGCGGAGGA
TGCCGCTCGACTTCTTAGTGACGCCATCAACTCCAGAGAC
AAAGATGAAGCAACTAAATACCTGAATCAACTTCTGGATC
TGAAACTCCCAGTGAGCGTCAAAATTAATCCAGATGCATA
TTCTCAAGACAACATCAGATTAAGAGTTGGAGTGGCTGAT
GCTGAATCAGAACATCACATCCCAATAACAGTGATGGTAC
CAGTTTACATGACAATATCCGAGCTGAAGGAAAAGATCAA
CGGTGACTATGGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations