Transcript

cyp2r1-201

ID
ZDB-TSCRIPT-110325-737
Name
cyp2r1-201
Previous Names
  • cyp2r1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050414 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050414|OTTDARG00000035423|ZDB-GENE-110114-1 cyp2r1|OTTDARP00000039574 cyp2r1-001 LG_none BX936464.7,AL954331.9 Danio rerio protein_coding KNOWN, 2317 bp
ATGATATCGATCAAACGCTTAACATCACCGCTCTCCTTGT
CCTGGGAGCAGACGCTGATATGTTTGCTCGGTTTGTTCAC
GACACTCTTGATTCTGCTGGTGATTCGCCAGCTCGTAAAG
CAGCGGAGACCCCGAGGGTTTCCCCCCGGACCGACACCTT
TGCCCATTATAGGGAATATGCTTTCCCTCGCCACAGAGCC
TCACGTCTACATGAAGAGGCAGAGTGACATCCACGGACAG
ATTTTCAGTCTAGACCTGGGAGGAATCCCGACTGTGATTC
TAAATGGTTATGATGCCATTAAAGAGTGCCTGTATCACCA
AAGTGAGGTTTTTGCAGACCGCCCGTCCCTCCCTTTATTC
CAGAAGATGACAAAAATGGGAGGACTTCTGAACTGCAAAT
ACGGCCGAGGCTGGATTGAGCACCACAAACTGGCTGTGAA
CTGCTTCCGCTACTTTGGCACTGGCCAGCGGATGTTTGAG
AGGATTTCTGAAGAGTGCCTATATTTTCTTGATGCCATTG
ACCAGCACCAAGGCAAGCCCTTTAACCCCAAGCATCTGGT
GACCAATGCGGTGTCCAATATCACCAACCTCATCATCTTT
GGCCAGCGCTTCACCTATGACGATGGGGATTTTCAGCACA
TGATTGAGATCTTCAGTGAGAATGTGGAGCTGGCAGCCAG
CAGTTGGGCTTTCCTGTACAACGCCTTCCCCTGGATGGAG
TACCTGCCCTTTGGGAAGCACCAGAGGCTGTTCCGCAATG
CCAACGAGGTCTATAAGTTCCTCCTGCAAATCATCAGGCG
CTTCTCGCAGGGCAGGGTTCCCCAGTCGCCGCAACATTAC
ATTGATGCCTACTTGGACGAAATGGAGCAAAGCACCCCTG
ATAAAGCCACTTCTTTCTCTCAAGACAATCTGATTTTCTC
AGTTGGAGAACTGATCATCGCGGGCACAGAAACCACCACT
AATTGTCTGCGCTGGGCTATGCTCTACATGGCTCTGTATC
CCAGGATACAAGAAAAGGTCCAAATGGAGATCGATAGTGT
TCTGAATGGCAGACAGCCTGCTTTTGAAGACAGGCAGAGG
ATGCCGTATGTGGAGGCAGTGTTGCATGAAGTCCTGCGCC
TCTGCAATATCGTCCCACTGGGAATCTTCCGCGCCACGTC
TCAAGACGCAGTGGTGCGTGGCTACACCATTCCCAAGGGC
ACCATGGTCATCACTAACTTGTACTCTGTACACTTTGATG
AGAAGTACTGGAGCGACCCGTCAATCTTCTGCCCAGAGCG
CTTTCTAGACTGCAATGGCAAATTCATCCGACATGAAGCG
TTTCTCCCCTTCTCCATAGGTAAGCGACACTGTTTGGGAG
AGCAGCTGGCCAGGCTGGAGATGTTCTTGTTCTTTACTAC
ATTGCTCCAGAGGTTTCACCTTCAGTTCTCAGAAGGCTTT
ATTCCGAGCCTCTCAGCGAAATTGGGCATGACCCTTCAGC
CTCAGCCGTATTCCATATGTGCCATCAGGAGGCAGCAGTA
AAACTTTCCAGCTTTGAGCTCTGGAACGCGTGCACTCACC
TCAGGGGATCCTACCAAGAAACGTCAAAGGCAGAGCAGTT
TCCAAGTCTTAAATTCCATCCCGTTTTCAACGGGTAATAC
TGACCTCTGATGTTGACTTGCTAAATTCTCTGAACGTGTC
CTCTTTAGTTTCACAGAAACCAGCCTGAGAGTGATAAGAG
TACTGTTACAGAACATGCTGTGAGGCGCACAGAATGAGCA
CATGTGTGTTACCGAACACGGACCTATAAGAGTTTCAAGA
TGAAGTGTAGCATGTATCTTTGATAACTTGAACTGAAAAC
GTGTACTGTGTAACAAAGCCAATGTTGTGCTTGTCAATAC
GAGAAGAGCTATTGTGTGAATGATTGACAGGGTTTACCTC
TATGATGGTTTGGACGGCCTGTCTTTTTCAGCATTCCTTG
AATTTCCCCATTTCTAGAGTGAGGAAAGCGAGAGGAGAAC
AGCTGCTTTTCTCAGAAAGTTTTGGAAATGCTTCAGGATT
CCTGTTGGTTTAATGCCATAGATCAGTTGTGCAATAATAT
CAGCCCAGTCCCTAGTTCATCTCACTGGAAAGAGATTATC
TAGAAACTCGAGCTGCCATATTTCTGAGGAAAAAACCATG
GTGCTCTCCTGAAAAACTGCACTGCAATATACATTTTATA
GAATATCTTTCTCTTTTTTTTACTTCACTTTTTAGACCAG
TGTTTGTGCTTATTATATAAAATGTCTGTCTCTAAAAAAA
AAAAAATAAAAAGAAATAAAAAACTTTTGTTATGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations