Transcript

cyp2r1-003

ID
ZDB-TSCRIPT-110325-1644
Name
cyp2r1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050412 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050412|OTTDARG00000035423|ZDB-GENE-110114-1 cyp2r1|no_translation cyp2r1-003 LG_none BX936464.7,AL954331.9 Danio rerio protein_coding KNOWN, 314 bp
GACCTGTGAGCGCGGGAGAAACACGTCGGATCAAAATGTC
GGCTTTCAGCGGCCTGTGCAGGTGTGTGAGTGGAACAATC
AGGAAATGAAGAGACGAAGGAACCAGGAGATGAGGAAACA
ACAACAAAGATCCAGTATTTAGTGTGCTGTACAAAGAGCT
GCAGAGGAACAGGAGAACAGAGACTTCATCCATGCTGCAG
GACACAGAATCTGCCCTGGACCACGGTGTCAAACAGATGA
GAGAAAAGGGCTTCATGAAATAAAGATCATTTTCTCAATC
TCACCGTAGCATGGCGCTGAAGTACAGAGAAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations