Transcript

cyp2r1-203

ID
ZDB-TSCRIPT-110325-2552
Name
cyp2r1-203
Previous Names
  • cyp2r1-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050413 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050413|OTTDARG00000035423|ZDB-GENE-110114-1 cyp2r1|OTTDARP00000039573 cyp2r1-004 LG_none BX936464.7,AL954331.9 Danio rerio protein_coding KNOWN, 813 bp
AGGGAGCAGACAAGGACGATCTGTCAGGACTCAAATGAGT
TCAGAATAGTGATGGAGCTGAAGTGTTAGTGTGAAACACA
CACAACTCTATCAACATTGTACTTGGATCAGACAATATTT
TCAGTCTAGACCTGGGAGGAATCCCGACTGTGATTCTAAA
TGGTTATGATGCCATTAAAGAGTGCCTGTATCACCAAAGT
GAGGTTTTTGCAGACCGCCCGTCCCTCCCTTTATTCCAGA
AGATGACAAAAATGGGAGGACTTCTGAACTGCAAATACGG
CCGAGGCTGGATTGAGCACCACAAACTGGCTGTGAACTGC
TTCCGCTACTTTGGCACTGGCCAGCGGATGTTTGAGAGGA
TTTCTGAAGAGTGCCTATATTTTCTTGATGCCATTGACCA
GCACCAAGGCAAGCCCTTTAACCCCAAGCATCTGGTGACC
AATGCGGTGTCCAATATCACCAACCTCATCATCTTTGGCC
AGCGCTTCACCTATGACGATGGGGATTTTCAGCACATGAT
TGAGATCTTCAGTGAGAATGTGGAGCTGGCAGCCAGCAGT
TGGGCTTTCCTGTACAACGCCTTCCCCTGGATGGAGTACC
TGCCCTTTGGGAAGCACCAGAGGCTGTTCCGCAATGCCAA
CGAGGTCTATAAGTTCCTCCTGCAAATCATCAGGCGCTTC
TCGCAGGGCAGGGTTCCCCAGTCGCCGCAACATTACATTG
ATGCCTACTTGGACGAAATGGAGCAAAGCACCCCTGATAA
AGCCACTTCTTTCTCTCAAGACAATCTGATTTTCTCAGTT
GGAGAACTGATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations