Transcript

hdac1-005

ID
ZDB-TSCRIPT-110325-439
Name
hdac1-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049194 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049194|OTTDARG00000034709|ZDB-GENE-020419-32 hdac1|no_translation hdac1-005 LG_ CU633192.7 Danio rerio protein_coding KNOWN, 849 bp
GTTTCCCCTCTACACAGGCAGCGTCTGTTTGAGAATCTGC
GGATGTTGCCTCATGCTCCAGGCGTTCAGATGCAGGCCAT
CCCGGAGGATGCAGTTCAGGAAGACAGCGGAGATGAAGAG
GACGACCCTGACAAACGCATCTCCATTCGTGCTCACGATA
AGCGGATAGCCTGTGATGAAGAGTTCTCAGACTCTGAGGA
TGAAGGCCAGGGTGGACGGAGAAACGCAGCCAATTACAAG
AAGCCAAAACGAGTGAAGACTGAAGAAGAGAAGGATGGAG
AAGAGAAGAAAGGTGAGCCAACAGGTACAAGCTGCTTATT
TTCATTTATTAGCAAGTACAGCAGATAGATTTGAGATCTT
TTGTTTGATTATACAGAAGTATTGTGTTTGAGTTTAGACA
AGTGAGATTAACACTCTTCATGTTTAATACCAGATGTTAA
AGAAGAGGAGAAAGCTTCAGAAGAGAAAATGGACACAAAG
GGGTAGGTCATCACTCTCATTGTGGACTTGAGAATATGTG
CTTTTCTGATATCAAGTGTCTCACTCGAAATTGGAGCCAT
TTTAGTTCCACGTGCCCATAACTTAATGTGACCTCAGAAT
CTAGATGGGCACATAATTATTATATCACATCTTCTGCATT
GCCTTGCACATGAATGCTGGATCAGGCTAAAAGATGAACT
TTTATATGCAGTGCTGCTTAATGTCAGTTCCAAAGCAGTG
GGTCAATCAATAAATCTAAGGCAGGGTGGATGTTGCAAGC
TTCTGTTTACAAAACATGGCATGACAACCATTTTATTTAA
TGTGCAACACACTGCAAGAGATGCAGACATGAGCTTTACG
GTCAAGCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations