Transcript

hdac1-201

ID
ZDB-TSCRIPT-110325-2253
Name
hdac1-201
Previous Names
  • hdac1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049190 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049190|OTTDARG00000034709|ZDB-GENE-020419-32 hdac1|OTTDARP00000038601 hdac1-001 LG_ CU633192.7 Danio rerio protein_coding KNOWN, 2242 bp
AGTGCGCAGAAAGCCCGGCAGGCGCAGGCTGTAATTGGAG
GGTAAAATGGCGCTGAGTTCTCAAGGAACAAAGAAGAAAG
TTTGCTATTATTATGACGGGGATGTCGGGAATTACTACTA
TGGTCAGGGCCATCCCATGAAGCCCCACAGAATCCGCATG
ACCCACAACCTTCTGCTCAACTATGGGCTGTATAGGAAAA
TGGAGATTTATCGACCTCATAAAGCCAATGCGGAAGAAAT
GACCAAGTACCACAGTGACGACTACATCAAGTTCCTCCGC
TCCATCCGCCCAGACAACATGTCCGAGTACAGCAAGCAGA
TGCAGAGATTTAACGTAGGGGAGGATTGTCCTGTCTTTGA
CGGCTTATTTGAGTTCTGTCAGCTCTCAACAGGTGGATCT
GTTGCTGGTGCGGTGAAACTCAACAAACAGCAGACAGACA
TTGCCATTAACTGGGCAGGAGGTCTACATCATGCTAAGAA
ATCAGAGGCATCTGGATTCTGCTATGTCAACGACATTGTA
CTGGCCATTCTGGAGCTGCTCAAGTACCATCAAAGAGTGC
TTTACATCGACATTGACATTCATCACGGTGATGGAGTTGA
GGAAGCCTTTTACACAACAGACCGTGTCATGACTGTGTCT
TTCCACAAGTATGGAGAGTATTTCCCGGGTACTGGAGACC
TCAGAGATATTGGTGCAGGCAAGGGGAAGTATTACGCTGT
AAATTACCCGCTCAGGGATGGTATTGATGATGAGTCCTAT
GAAGCCATATTCAAACCTATCATGTCCAAAGTGATGGAGA
TGTACCAGCCCAGTGCTGTGGTGCTCCAGTGCGGCGCTGA
CTCTCTGTCCGGAGATCGATTGGGCTGCTTTAACCTTACC
ATTAAAGGTCATGCCAAGTGTGTAGAGTACATGAAGAGCT
TTAACCTGCCGCTGCTCATGCTGGGAGGTGGAGGCTACAC
CATTAGAAACGTGGCCCGCTGCTGGACTTTCGAGACAGCT
GTAGCACTGGACAGCACCATTCCTAATGAGCTCCCGTACA
ATGATTACTTTGAGTATTTTGGACCTGACTTCAAGCTCCA
CATCAGCCCCTCCAACATGACCAATCAGAACACAAATGAC
TACCTGGAAAAGATCAAGCAGCGTCTGTTTGAGAATCTGC
GGATGTTGCCTCATGCTCCAGGCGTTCAGATGCAGGCCAT
CCCGGAGGATGCAGTTCAGGAAGACAGCGGAGATGAAGAG
GACGACCCTGACAAACGCATCTCCATTCGTGCTCACGATA
AGCGGATAGCCTGTGATGAAGAGTTCTCAGACTCTGAGGA
TGAAGGCCAGGGTGGACGGAGAAACGCAGCCAATTACAAG
AAGCCAAAACGAGTGAAGACTGAAGAAGAGAAGGATGGAG
AAGAGAAGAAAGATGTTAAAGAAGAGGAGAAAGCTTCAGA
AGAGAAAATGGACACAAAGGGGCCAAAAGAAGAATTAAAA
ACAGTGTGAGGTGGGGGAGAAGGACTGCCAGTCCTCCTGG
ATGCATGTACTTAAGTCGTCAAACACCCTCATCTTCAAAC
ATCAAACCCACATTTACACACACACACATACACATACATG
CTAGATGTTAGCTCTAGTCCTGAGCTAAGGACTGTAAATT
ATTTTGTAAGACTCGTTTTACTATTTGTAATCTAATGAAG
CGGTATAAAAGTTTTTACATTTACAAGTGTGAAATGACCA
GATGTTTTTTTGTTTCGTGCTTTGGAACCATGTTTGTTTG
CCTCCCTTATGTTACTATTTAGCGACGATAGCACCTCAGA
CACAGGACCACAAATAGCACATAACTTTACTGTCCCATCA
TGGGATGCTTTTTTTTCTCTTCCCCCTCCCCCTCAAATAA
TTTTAAATCATGGATGGAGATACTTATTGGCCGCTCTTAC
TTGGGTTTTCTCTGCGGATGCTGTTTGGTGTCCGGTGTCC
TTTACCTCGTTTTTAAGCGCTAAATGTTTGGTTTTTATTC
TGGTGTCTGTCTCTCGATACCTACATCTGTGCGGTGTGTA
AGTACTCCGGTATGGTCGGGGCATGGCGAAGGCTTGCTGT
ATTGCTGTTAGATTCAAGATTTTTCTTTCTGTTGTGCTTT
ATTCTAGCATGTCAGTCGTGCAGCTGACCAGACATTTAGC
CGTTTGGATTTTCCAGAGTTCAGTGGTTGTGAAATGTCCT
TATTATAACAATGATTTTGGTAAATAAAGAGAAGTTCTCT
GA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations