Transcript

hdac1-004

ID
ZDB-TSCRIPT-110325-1346
Name
hdac1-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049192 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049192|OTTDARG00000034709|ZDB-GENE-020419-32 hdac1|no_translation hdac1-004 LG_ CU633192.7 Danio rerio protein_coding KNOWN, 1249 bp
CCGGCAGGCGCAGGCTGTAATTGGAGGGTAAAATGGCGCT
GAGTTCTCAAGGAACAAAGAAGAAAGTTTGCTATTATTAT
GACGGGGATGTCGGGAATTACTACTATGGTCAGGGCCATC
CCATGAAGCCCCACAGAATCCGCATGACCCACAACCTTCT
GCTCAACTATGGGCTGTATAGGAAAATGGAGATTTATCGA
CCTCATAAAGCCAATGCGGAAGAAATGACCAAGTACCACA
GTGACGACTACATCAAGTTCCTCCGCTCCATCCGCCCAGA
CAACATGTCCGAGTACAGCAAGCAGATGCAGAGATTTAAC
GTAGGGGAGGATTGTCCTGTCTTTGACGGCTTATTTGAGT
TCTGTCAGCTCTCAACAGGTGGATCTGTTGCTGGTGCGGT
GAAACTCAACAAACAGCAGACAGACATTGCCATTAACTGG
GCAGGAGGTCTACATCATGCTAAGAAATCAGAGGCATCTG
GATTCTGCTATGTCAACGACATTGTACTGGCCATTCTGGA
GCTGCTCAAGTACCATCAAAGAGTGCTTTACATCGACATT
GACATTCATCACGGTGATGGAGTTGAGGAAGCCTTTTACA
CAACAGACCGTGTCATGACTGTGTCTTTCCACAAGTATGG
AGAGTATTTCCCGGGTACTGGAGACCTCAGAGATATTGGT
GCAGGCAAGGGGAAGTATTACGCTGTAAATTACCCGCTCA
GGGATGGTATTGATGATGAGTCCTATGAAGCCATATTCAA
ACCTGTAAGTCTGTAAACCGTACCAGATGTGACGATGTGT
TTCTCTGAAATCAAGTCATGCAAATCTCCTTGTTTCTGAT
TGTCCTGTAGATCATGTCCAAAGTGATGGAGATGTACCAG
CCCAGTGCTGTGGTGCTCCAGTGCGGCGCTGACTCTCTGT
CCGGAGATCGATTGGGCTGCTTTAACCTTACCATTAAAGG
TCATGCCAAGTGTGTAGAGTACATGAAGAGCTTTAACCTG
CCGCTGCTCATGCTGGGAGGTGGAGGCTACACCATTAGAA
ACGTGGCCCGCTGCTGGACTTTCGAGACAGCTGTAGCACT
GGACAGCACCATTCCTAATGAGCTCCCGTACAATGATTAC
TTTGAGTATTTTGGACCTGACTTCAAGCTCCACATCAGCC
CCTCCAACATGACCAATCAGAACACAAATGACTACCTGGA
AAAGATCAAGCAGCGTCTGTTTGAGAATCTGCGGATGTTG
CCTCATGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations